MARSH FAMILIES
DNA PROJECT

John Marsh, Project Administrator, ajmarsh@arrrg.org
1) Information about the DNA Project

Return to Home Page:

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License.
http://creativecommons.org/licenses/by-nc-nd/3.0/


This Web site is dedicated to the memory of Bill Marsh who died in Canada 24 Sept 2010.  Bill, a well known researcher of Kent Marshes has helped many Marshes around the World find their roots.  It was Bill who prompted the founding of the Marsh Families DNA Project.  Bill will be missed, but this project he helped to found still lives.  Long may the project carry on the good work of Bill in helping Marshes around the World find their roots.

CONTENTS:

1) THE MARSH FAMILIES DNA STUDY:
2) PROJECT GROUP ADMINISTRATOR:
3) GOALS OF THE MARSH DNA PROJECT:
4) HOW DNA IS USED IN GENEALOGY:
5) FREQUENTLY ASKED QUESTIONS:
6) REFERENCE INFORMATION ON DNA:
7) MUTATION RATES FOR INDIVIDUAL Y-DNA MARKERS:

1) THE MARSH FAMILIES DNA STUDY:

All males pass on their Y-Chromosome DNA (Y-DNA) to their sons, mostly unchanged.  This means that all males descended on the direct male line from the same ancestor, have identical, or nearly identical Y-DNA.  By testing the Y-DNA of Marsh males from around the World, we can find which are related.  Sometimes we can also learn about the deep ancestry of the family, perhaps where the family may have originated, hundreds, or even thousands of years ago, and sometimes we get indications of possible early ancestors living hundreds of years ago. 

A MARSH FAMILES DNA PROJECT was started on 23 Sept 2003.   Males with related surnames of MASH/ MARCH/ MARIS/ MARRIS/ MARESH/ MARSCH, and variant spellings, are also invited to participate in this project, as these surnames in some cases have common roots to persons using the surname Marsh. 

Following is a detailed description of the project, it's goals, how DNA is used for genealogical purposes, and reference information on DNA.  If you are a Marsh interested in participating in the study, or have any questions, please contact the Project Group Administrator, John Marsh, at ajmarsh@arrrg.org .   We would welcome participation of any male Marshes. 
.
2) PROJECT GROUP ADMINISTRATOR:

The Project Group Administrator: John Marsh

E-mail address: ajmarsh@arrrg.org 
Postal Address: AJ Marsh, 26 Highcrest Heights, Christchurch 8025, NEW ZEALAND.
Marsh Families DNA Web Site:
http://kin.marshdna.com

The Marsh Families DNA Project is being run on a voluntary, non profit basis, by enthusiastic amateur genealogists, with an interest in contributing something of benefit to the wider community of Marsh genealogists around the World.  Apart from John Marsh, there is a group of Marsh genealogist around the World, from different Marsh families, who lend moral support, and help out in various ways.  We would welcome involvement from any other Marsh genealogists, so if you feel you have something to offer the project, in any way, we would be pleased to hear from you.  

3) GOALS OF THE MARSH DNA PROJECT, AND GENERAL INFORMATION ABOUT THE PROJECT:

  1. Project for all male Marshes: The Marsh Families DNA Project is intended for any male with the surname of Marsh, or variant spellings.  There is evidence that Maris, Marris, Maresh, Marsch, Mash, and March families in some cases have common roots with persons using the surname Marsh, so persons of these surnames are also invited to participate in the project.  There are 260 variant spellings recorded for Marsh. (see  http://www.imagepartners.co.uk/Thesaurus/Search.aspx )  Sometimes the surnames of variant spelling only relate to Marsh families if they arise in particular contexts.  If anybody interested in the project has a surname which they believe is a related variant of Marsh, please contact the Project Administrator.  Males "of surname Marsh" who may have obtained the name from adoption, or from a maternal line, are also welcome to participate in the project.  Their male line descendants in the future will carry the name of Marsh, and may be interested to use the results of this study to help them trace their roots. 
  2. Marsh Y-DNA Database: The goal is to build up a database of Marsh family Y-DNA profiles to assist Marshes world wide to trace their ancestral roots, and also locate possible long lost branches of their families.   See http://marshdna.arrrg.org/DNAresults.htm .
  3. Only direct male line male Marshes can be tested- but females can help!: The Y-DNA (Y-Chromosome DNA) tests being done through this project only test a part of DNA which is passed on from fathers to their sons. Females don’t have Y-DNA, so are unable to be tested themselves. However, many females of Marsh descent are interested to learn about their ancestral Marsh Y-DNA.  It may be possible for them to find a known direct male line Marsh relative (father, brother, uncle, grandfather, cousin etc) who would agree to be tested on their behalf.  We now have quite a number of females of Marsh descend who have managed to drag a male relative into the project, (kicking and screaming ... or even willingly).  Many thanks to these wonderful "Lady Marshes" for their support, and contributing such a lot to the success of the project. 
  4. DNA Test Companies- Prices for the Marsh Families DNA Project Group:  The DNA testing market is becoming more competitive.  Several companies are currently being used for Y-DNA tests for this project.  Each company offers a different range of test options, testing different numbers of markers.  Generally, the more markers tested, the more useful the results, and 25 would be a desirable minimum.   However, if cost is an issue, the testing of a smaller number of markers is a good starting point.  It is recommended that interested persons contact John Marsh to discuss which options might be appropriate, and which test company might better suit a specific case.  (Some families have distinctive family markers tested by one test company, but not another.)   Prices from the test companies below may change from time to time.  Also, periodically there are discounts or special prices offered by various companies.  Most companies have at least a small postage and handling charge to add to costs.
    1) Family tree DNA:   (NOTE: contact John Marsh at ajmarsh@arrrg.org to obtain access codes to obtain the following discounted prices for the Marsh Families DNA Project if testing with FTDNA.  FTDNA offer free DNA storage for 25 years.)  This test company has the most extensive range of markers tested, and is the most frequently used test company for surname projects.  This company stores DNA free for up to 25 years, enabling new tests to be ordered in the future without submitting a new sample, and in the event of testing an elderly relative, DNA will be available for testing in the future as DNA technologies develop, even if the person is no longer living.
      Option 1: Y-DNA12 male 12 marker paternal test $99 USA (Group price) - STARTER
      Option 3: Y-DNA37 male 37 marker paternal test $149 USA (Group price) - GOOD
      Option 4: Y-DNA67
    male 67 marker paternal test $248 USA (Group price) - BETTER 
      Option 5: Y-DNA111 male 111 marker paternal test $339 USA (Group price) - BEST
    2) DNA Ancestry:  Information see http://dna.ancestry.com/buykitGoals.aspx
     
    Option 6: Y-DNA 33 marker test $149 USA- GOOD
     
    Option 7: Y-DNA 43 marker test $199 USA- BETTER

    6) OTHER TEST COMPANIES:  (NOTE:  If someone is thinking of testing with another test company, feel free to contact John Marsh at ajmarsh@arrrg.org   to discuss how services compare.  If you are new to DNA testing, it might be helpful to discuss the significance of various differences in services offered by different test companies.  Some basic differences are at
    http://www.isogg.org/wiki/Y-DNA_testing_comparison_chart , but price is not the only consideration.)
     
  5. Testing is easy:  Different test companies have slightly different test kits, but most involve just rubbing a plastic scraper/ swab on the inside of the mouth.  One surname project has a photographic "how to" guide, see... http://davedorsey.com/dna.html  .  Test can be ordered on the internet, test kits are posted to the customer, and they simply follow the instructions on how to take the test, and post the DNA sample back to the test company.
     
  6. Sponsorship:   Some interested male line Marshes have indicated that the cost prevents them from participating, and other Marsh descendants who are not on the direct male line, have indicated they would contribute something towards the cost of tests if a male line Marsh relative was prepared to supply a DNA sample.  If you are a Marsh male who would participate if assistance was given with test costs, or if you are a Marsh descendant who is prepared to contribute a donation large or small towards testing your Marsh relatives, please contact the Project Administrator.  If anybody is prepared to make a donation towards test costs, this may have any conditions placed on it, eg that it apply to only a specific line of a specific family.  The test company Family tree DNA has set up "general funds" for all the surname projects who use their company.  They have set up a "Marsh General Fund" to handle donations for DNA testing.  Only the Marsh Project Administrator can authorize allocation of the use of the money, and it can only be used for DNA testing.  This system works well, and ensures that donations are only used for their intended purpose, DNA testing.  To contribute, see www.familytreedna.com/contribution.html, but be sure to record on the form, that the donation is to the "Marsh" fund, as there are separate funds for about 1200 different surnames.  I suggest any donors contact me, and advise if the donation is to be restricted for use to descendants of a particular family. 
  7. Results posted on Marsh Families DNA Web Site: When Y-DNA test results are available, each participant will (unless they request not to) have their results included on the Marsh Families DNA Project web site.  Participants will not be identified by name (unless they request to be identified). The results will be identified by an anonymous number selected by the Project Administrator.  The results are shown at http://marshdna.arrrg.org/DNAresultsextra.htm .
  8. Earliest known Marsh ancestor of participants: It is expected that participants will provide the Group Administrator with the name of the earliest known Marsh ancestor, and the location which that ancestor was from. This information will be given on the web site unless the participant requests that it is not shown, in conjunction with the participant’s anonymous ID number, and the results. This is an important aspect of the project, as it is through the linking of Y-DNA to specific ancestors, and ancestral territories, that enables us to help each other to further our knowledge of our families.
  9. Privacy: Privacy of participants is a very important consideration. No participant will be named on the Web Site without authority from the participant. The group administrator gives an undertaking to remove from the Marsh Families Web Site any information previously supplied by an individual participant, or test results relating to that participant, if requested to do so by the participant.  If any participant has any particular concerns about privacy, these should be able to be accommodated. 
  10. Project Administrator to have discretionary authority: The purpose of this project is to enable kinsmen to make contact with each other, and help each other further their knowledge of their families. It is expected that unless directed otherwise by individual participants, the Project Administrator will have authority to discreetly arrange contact between participants whose test results, or other circumstances, indicate possible family connections.
  11. Additional family history and contact information: Participants may offer contact information, and information on their family history or family tree, for inclusion on this web site. The Project Administrator will attempt to incorporate this information in a suitable way.  As time allows, separate web pages will be added where links and some family tree information can be added for specific Marsh families.  On the page at http://marshdna.arrrg.org/DNAprojects.htm are links to some of these specific Marsh family pages.
     
  12. Obtaining DNA samples from persons no longer available for testing, eg deceased relatives:  
    Many persons interested in participating in the Marsh Families DNA Project are persons who are not "direct male line" descendants of Marshes, and know of no living male line who can be tested.  It is sometimes possible to obtain DNA from the following items.  However, it is more expensive to process DNA samples from these sources, and some items have a very low chance of success.  A big problem with obtaining DNA this way is the chance of contamination by other people handling the DNA, and getting their own DNA transferred to the sample.
    • Hair
    • Teeth
    • Dentures
    • Toothbrush
    • Dental Floss
    • Razors and Electric Razor Clippings
    • Fingernail or Toenail Clippings
    • Hearing Aid
    • Ear Wax
    • Used Kleenex
    • Gum
    • Cigarette Butts
    • Clothing Stained with Blood or Sweat
    • Licked Envelopes and Stamps
    • Urine
    • Medical samples held in hospitals from tests done during a person's life.
       
  13. An evolving project: The Marsh Families DNA Project is an evolving entity. The Project Administrator is open to any suggestions from participants or others about how the project might be improved.

4) HOW DNA IS USED IN GENEALOGY:

The availability of DNA tests in recent times has offered genealogists some exciting possibilities. In males, part of the DNA, the Y chromosome (Y-DNA), is passed on from fathers to sons (but not to daughters) normally completely unchanged for many generations. This means when a father passes on his surname to his son, he also passes on his Y-DNA, which is like an invisible bar code version of the surname. If a Marsh in USA, and a Marsh in Australia, Canada, New Zealand, England or elsewhere, had a common direct male line ancestor 10 or 20 generations in the past, a DNA test would show that they have identical or very similar Y-DNA.

In genealogical Y-DNA testing, typically 12, 25, 37, 43, 67 or more "markers" are tested on the Y chromosome.  However, research is rapidly advancing, and more than 100 markers are now currently commercially available, and before long there will be many more.  There are different sorts of markers, eg STR markers, and SNP markers.  We test STR markers in the Marsh DNA project, and some interested in their deeper ancestry have also tested SNP markers.  It is not necessary to understand how DNA works to use it for genealogy.  All you basically need to do, is see if the "marker scores" of one person "match" another person.  A close match basically means a closer relationship.  But what we are measuring  in Y-DNA tests is interesting. 

In the DNA molecule, there are component molecules, each known by different letters C, G, T, and A which are jointed together in spiral strings.  There are around 60,000,000 letters making up the Y-DNA alone, which is only a small part of each DNA molecule.  Mostly, the strings are seemly random collections of letters.  However, sometimes parts of these strings are made up of a few letters which are repeated.  For example, one of the markers which we test is a STR marker called DYS391.  A small part of the DNA around this marker is shown below.  The part shown in blue, is STR marker DYS391.  Note that this is made up of 11 "repeats" of the 4 letters TCTA.  When a father passes his Y-DNA on to his son, the whole 60,000,000 letters of the Y-DNA are copied.  However, sometimes when the Y-DNA is copied, a "mutation" occurs, and one part is not copied exactly.  Sometimes, in the copying process, when half of the TCTA repeats have been copied, the original DNA strand being copied accidentally gets slid along the copy it is making, and gets out of line by exactly one TCTA repeat segment, and it accidentally copies the TCTA repeats one time too many (or one time too few).  ( http://web-books.com/MoBio/Free/Ch7F3.htm )  So in this case, we would count the father's repeats, and say he had 11 repeats of TCTA in DYS391, and his score on that marker is 11.  However, if one of his sons had 12 TCTA repeats, his son would have a marker score of 12. 

TTCAATCATACACCCATATCTGTCTGTCTG/TCTA/TCTA/TCTA/TCTA/TCTA/
TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/
TCTGCCTATCT
GCCTGCCTACCTAT
CCCTCTATC

If a father had 6 sons, perhaps 5 of his sons would inherit the DYS391=11 that he had, but one son might inherit 12 in the way that I have described above.  All of the other markers tested might have identical values for all 6 sons. This means in 10 generations time, the chances are that the descendants of the 5 sons with a value of DYS391=11, will still probably have a value of 11, but the descendants of the son with a value of 12 will probably have a value of 12 for that marker. This means that by testing a male’s Y-DNA, and seeing what values he has for the markers, sometimes it is possible to predict where he might be related on a particular family tree, particularly if he has some distinctive markers which only occur in one branch of the family.  If we get lucky, sometimes we might be able to say that a person is probably descended from an identified ancestor living hundreds of years ago.  In the Marsh project, we have be able to tell a number of participants that they likely descend from particular Marsh pioneers in USA in the 1600s.  When we have sufficient participants from different branches of families, we should be able to identify specific branches which Marshes are likely to have come from.

With a Y-DNA test, if two males matched on 25 of 25 markers, it does not "prove" they are closely related, but it does indicate that it is "very likely".  We look for corroborating evidence to support matching DNA results, and if the 2 males had the same surname, and traced their ancestors back to the same village, it clearly increases the likelihood of them being relatively closely related.  If two males of the same surname matched on only 10 of 25 markers, it would be considered conclusive evidence that the two were not closely related on the direct male line, and their most recent common direct male line ancestor might have been many thousands of years ago. Statisticians have of formulas for estimating probabilities of how many generations back to a Most Recent Common Ancestor ("MRCA"), for different numbers of matches on markers.

The goal of the Marsh Families DNA Project is to test as many Marsh males as possible from as many different families and locations as possible, and build up over time a database of different Marsh family Y-DNA profiles. Ideally for very large Marsh families, 4 or more separate remote branches of the family should be tested, to get a better indication of what the ancestral Y-DNA profile would have been. If only one branch is tested, it could be the only branch that has mutations on it, and it might give a misleading indication of the probable ancestral Y-DNA for that family. As this database builds up, it will become a valuable tool for genealogists, and help Marshes around the World to gain clues to their ancestral origins, and possibly find long lost branches of their families.  In the Marsh DNA project so far, we have linked a number of Marshes to their ancestry, confirmed suspected ancestries in some cases, and linked Marshes to their lost lines of cousins.

A secondary goal for participants in this project, would be the chance to learn something of their "deep ancestry".  By this I mean indications of the broad tribal origins they stem from in the direct male line, over the past tens of thousands of years. The genetic scientists have developed basically a family tree of mankind, which identifies different "haplogroups", which are related groupings, and this enables us to identify the corner of the big picture that we individually fit into. (see http://isogg.org/tree/ & http://www.familytreedna.com/haplotree.html.)  Working from the "haplotree", and distribution patterns of person of similar haplotypes, it is possible to in general terms plot the trail of our ancestors out of Africa, up to the last Ice Age, and sometimes get indications on the ancestral trail over the years since the Ice Age.  On the results page at http://marshdna.arrrg.org/DNAresults.htm   has been included a tree of all Marsh families identified in the Marsh DNA Project, and shows their approximate deep ancestry linkages, and the migration trails over the millennia.

5) FREQUENTLY ASKED QUESTIONS:

The Project Administrator of the Marsh Families DNA Project, is using Y-DNA test results to attempt to trace relationships between various Marsh families around the World, and to trace deep ancestry origins.  The Project Administrator is not an "expert" on all aspects of  DNA, or Y-DNA, which are rapidly advancing areas of science.  For anyone interested in more background information on the parts of DNA typically used in genealogy, it is suggested the "Frequently Asked Questions" sections of DNA Test Company web sites, and other related sites,  may be helpful.  See the following...
http://www.familytreedna.com/faq.html (Family Tree DNA- FAQs)
http://www.dnaheritage.com/faqs.asp   (DNA Heritage- FAQs)
http://www.dna-fingerprint.com/modules.php?op=modload&name=FAQ&file=index  (DNA Fingerprint- FAQs)
http://www.le.ac.uk/genetics/maj4/SurnamesFAQ041008.html   (Dr Mark Jopling, Leicester University)

Sorenson Molecular Genealogy Foundation (SMGF) were offering free tests in their research project, and are investigating Y-DNA and mtDNA as used by most commercial test labs, but they are also looking at additional parts of the DNA to learn about genealogical relationships.   For information more specific to SMGF see the following...
http://smgf.org/faq.html  (Sorenson Molecular Genealogy Foundation- FAQs)

6) REFERENCE INFORMATION ON DNA:

NOTE:  There is so much information now available that this following list is not now updated very often, and some links may not be current.

There is a huge amount of information on the internet about DNA testing in relation to Surname Study Projects, such as this Marsh study.  Following I have listed sites with general reference information on various aspects of Y-DNA.  I have roughly divided these links up under topic headings. 

Participants in the Marsh DNA Project don't need to know about the "technical" side of DNA, but for those who are interested to know how it all works, they can have a look around the following sites.  The information may seem bewildering, but once a person has been tested, and knows something about their own DNA, it makes it easier to make sense of the reference material.  If you know what your Y-DNA is, you can look for information specifically relating to you own Y-DNA, and you don't have to be confused by volumes of information irrelevant to your own case.

If anybody has been looking through the following sites, and don't understand something, please contact the Project Administrator.  He may be able to answer your query, or at least know where to look for an answer.

DNA Task Force Flier/ DNA Articles etc:
http://www.dnalist.net/Flyer/index.html *****
http://www.genealogydna.org/speakerslist (DNA Task Force Speakers List)
http://www.newstimeslive.com/news/story.php?id=1009519 (National Geographic DNA Project)
http://freepages.family.rootsweb.ancestry.com/~bonsteinandgilpin/  (A useful introduction to genetic genealogy from one surname project web site)*****
http://en.wikipedia.org/wiki/Genealogical_DNA_test (introduction to DNA testing for genealogy)
http://dnanews.org/top-10-dna-news-websites/  (Top 10 DNA web sites Jan 2011)
 


DNA Web Pages- general explanations about DNA, and giving references to useful DNA links: 
http://www.yourgeneticgenealogist.com/2013/08/kelly-wheatons-beginners-guide-to.html (beginners guide)
http://worldfamilies.net/helpful_tools.htm   (DNA helpful tools) ***
http://www.isogg.org/ 
International Society of Genetic Genealogists web site
http://isogg.org/successstories.htm (Success stories from DNA genealogy)
http://www.isogg.org/tree/ISOGG_Glossary08.html  (Glossary of Genetic Terms)
http://www.isogg.org/newsarchives.htm  (ISOGG DNA News Archives) *****
http://www.genetealogy.com/articles/html/   (Links to DNA articles on various topics)
http://vetinarilord.blogspot.com/    (DNA articles on various topics- good site)***
http://freepages.genealogy.rootsweb.com/~ncscotts/
 (Scott DNA site- excellent)******
http://www.contexo.info/DNA_Basics/Meiosis.htm
 (Basic biology for genetic genealogy)
http://learn.genetics.utah.edu/units/basics/index.cfm  (DNA basics and beyond)
http://freepages.family.rootsweb.ancestry.com/~bonsteinandgilpin/  (A useful introduction to genetic genealogy from one surname project web site)*****
http://genealogy.about.com/cs/geneticgenealogy/a/dna_tests.htm   (Tracing your ancestry through DNA)
http://www.kerchner.com/dna-info.htm   (Kercher web page- General DNA reference material)
http://freepages.genealogy.rootsweb.com/~allpoms/genetics.html   (Pomery's DNA site)
http://blairdna.com/dna101.html   http://blairgenealogy.com/dna/dna101.html  (Blairs DNA 101)* 
http://www.familytreedna.com/dna101.html   (FTDNA DNA 101)*
http://www.historicalgenetics.com/ (Historical Genetics)
http://gslc.genetics.utah.edu/units/basics/tour/
http://www.dnaheritage.com/tutorial1.asp
http://freepages.genealogy.rootsweb.com/~gkbopp/DNA/DNAtimeline.htm (DNA historical time line of events)
http://worldfamilies.net/helpful_tools.htm (Helpful Tools)
http://worldfamilies.net/y-haplogroups.htm (Y-Haplogroups)
http://worldfamilies.net/mtDNA.htm   (mtDNA)
http://worldfamilies.net/regional_project.htm (Geographical Projects)
http://www.chezmaya.com/divers/moving.htm   (What Y-DNA looks like)
http://www.ancestry.com/learn/library/article.aspx?article=9816   (Genetic genealogy- survey)
http://freepages.genealogy.rootsweb.com/~geneticgenealogy/  (eclectic collection of DNA links-Little)
http://www.dnafiles.org/resources/index.html (Miscellaneous information about DNA, not specifically about genealogical use of DNA)
http://www.smgf.org/resources/papers/PosterASHG2003.pdf  (Pilot project showing how autosomal DNA can be used in genealogy)
http://knordtvedt.home.bresnan.net/
http://dgmweb.net/DNA/DNA-hub.shtml

DNA Surname Projects being carried out:
http://www.worldfamilies.net/  (World Families Network- comprehensive DNA project list)
http://www.dnalist.net/  (DNA surname projects)
http://www.duerinck.com/surname.html  (Duerinck webpage- gives a list of surname projects being done)
http://www.le.ac.uk/genetics/maj4/surnames.html   (Research project on surnames & DNA)

DNA Test Companies:
https://www.facebook.com/groups/yfullcom/ (genome interpretation service)
http://www.yseq.net/   http://shop.yseq.net/  (Testing individual SNPs)**************
http://www.personalgenomes.org/  (Sharing personal genomes project)
http://dna.woodruffgenealogy.net/ydnacomp.htm  (Test company comparison chart)
*****
http://spreadsheets.google.com/pub?key=pUnr6rAB3u4lLJBq9_6t1Uw
(Test company calibration adjustments)*****
http://www.youtube.com/watch?v=AN07Adpu7Bs (You Tube video on how to take a DNA test, shows FTDNA test kit)
http://dgmweb.net/genealogy/DNA/ConversionFactors.shtml
http://www.genetealogy.com/resources/html/cat11.html 
(List of main test companies)
http://dnaconsultants.com/dna_tests/index.html?gclid=COaDx8CV-Y4CFQSOggod63Tv3g (DNA Consulting)
http://freepages.genealogy.rootsweb.com/~bonsteinandgilpin/dna/ydnaco.htm (List of markers tested by various companies)
http://www.thegeneticgenealogist.com/comparison.htm).2  (Comparisons of many of the genealogical DNA testing companies, note prices given for some companies don't include sizable discounts offered to surname projects being don't through those companies.)
http://www.thegeneticgenealogist.com/markerlist.htm).Blaine  (Comparison of markers tested by different test companies.)
www.familytreedna.com or www.familytreedna.co.uk   (Family Tree DNA)***
http://www.igenea.com/genealogy-dna-result-certificate-ancestry-07.htm 
(iGENEA)
(A company with a wide range of DNA services, good resources to assist customers, and a very good reputation for customer services.  See http://www.ftdna.com/sitemap.html for FTDNA web site map.  Note FTDNA invite interested genealogists to subscribe to their free DNA newsletter.  For anyone considering whether DNA has any use in genealogy, this newsletter/ magazine is a good way to get monthly updates and information on the use of DNA in genealogy... see http://www.familytreeDNA.com/fgregister.asp    Past issues of the newsletter can be seen at http://www.familytreeDNA.com/facts_genes.asp?act=past   Several have been intrigued by the report on the Meates project in the past issue of the magazine at the following link, this dramatically shows how DNA can be used in genealogy...  Facts & Genes Volume 3, Issue 6, October 21, 2004 ***)
http://www.dna-fingerprint.com/static/FTDNA-Conference-2007-WalkOnY.pdf  (FTDNA Walk on Y Project)
http://www.igenea.com/index.php?content=31&test=y-12-group  (FTDNA Swiss Office)
http://online.wsj.com/public/article/SB119509026198193566.html  (African DNA)
http://www.cambridgedna.com  (Cambridge DNA- Cambridge DNA Services offers autosomal DNA ("admixture"), mtDNA ("motherline"), and Y-DNA ("fatherline") tests for use in personal ancestry research.)
http://www.tracegenetics.com/services_gene.html   (Trace Genetics- has large Native American database)
http://www.tracegenetics.com/services_gene.html#WYSNP   (SNP tests)
http://www.ancestrybydna.com/  (Ethinic Composition)
http://africanancestry.com/  (African Ancestry)
http://www.vita-med.com/ancientdna.cfm   (Remains Testing)
http://www.ancientdna.com/links.html
http://www.isogg.org/wiki/Ancient_DNA  (Links to companies testing ancient DNA)
http://www.geogene.com/index.htm   (GeoGene)
http://beta.genetrack.com/index.php   (Genetrack)
http://www.oxfordancestors.com/   (Oxford Ancestors)
http://www.rootsforreal.com/english/eng-home.html   (Roots For Real- MtDNA only?))
http://www.0800-gentest.de/  (biotix GmbH- Germany)
http://www.genbygen.de/genealogie_genotypisierung.htm   (GenByGen- Germany)
http://smgf.org/page.jspx?name=participate   Participating for FREE in the Sorenson Molecular Genealogy Foundation DNA research project would assist the Marsh Families DNA Project:  (((AS AT 2009, SMGF HAVE RESTRICTED ACCESS TO FREE TESTS, HAVING REACHED THEIR INITIAL GOAL OF 100,000 FREE TESTS))) (Sorenson research project- not strictly a test company, but is (WAS) offering free tests in a research project.  Results are are not directly given to participants, but there are ways they can be obtained.   Contact John Marsh for suggestions about how to obtain results.  I recommend that all male Marshes consider being tested. In the long run, it would be a huge help to the Marsh DNA Project to have a wide range of Marshes tested.  Please tell John Marsh if you are tested in the Sorenson research project, as it will make it easier to locate results, if it is known who has been tested.  The free tests will not be offered indefinitely, so if you are interested, take your chance while it is there.  Being a research project, they are doing a wider range of tests than commercial test labs, so it may be that we learn some remarkable things not obtainable from other sources.) 
http://www.businesswire.com/portal/site/google/index.jsp?ndmViewId=news_view&newsId=20080120005047&newsLang=en ((( Sorenson obituary)))
http://www.smgf.org/pages/smgf_genetree.jspx (relevant in relation to SMGF above)
http://dnawitness.net  (Ancestry by DNA)
http://www.ancientdna.com/  (Ancient DNA, not structured for normal genealogical DNA testing, but may be useful trying to recover DNA from artifacts belonging to deceased ancestors.)
http://www.biotix.de/index.php?newlang=eng (Biotix, German company, ... offering some good services, renamed DNA Fingerprint, see new contact details below)
http://www.dna-fingerprint.com   (DNA Fingerprint, new name for biotix)*****
http://www.isogg.org/extractionchart.htm  (DNA extraction from personal effects, hair, stamps etc)

http://www.ethnoancestry.com/   (Ethnoancestry)*****
https://www5.nationalgeographic.com/genographic/ (National Geographic Genographic Project- not strictly a test company, and the results are not primarily designed for "genealogical" purposes.  However, anyone with results from the Genographic Project will be able to use their results to get some comparison to Marshes tested in the Marsh DNA Project.  Any Marsh tested in the Geonographic project is invited to contact John Marsh ajmarsh@arrrg.org, for assistance with comparing to Marshes in the Marsh Families DNA Project.)
http://www.ftdna.com/ftdna_genographic.html (FTDNA site, comments re National Geographic Project)
http://www.clanlindsay.com/new_page_4.htm  (List of markers tested by test companies)
http://www.chromosomal-labs.com  (Chromosomal Laboratories)
www.dnatribes.com
www.healthanddna.com/genealogy.html   (Genelex)
http://www.genebase.com/   
http://www.genebase.com/blog/?p=62 (Genebase markers)
http://www.preventiongenetics.com/  (Method for good quality long term DNA storage.)***
http://dnaaction.com/usa/dna-preservation.asp  (DNA Preservation Service)
http://www.dnaancestryproject.com/ydna_intro_howto.php
http://www.argusbio.com/about_us.html?osCsid=205c1c824eb40df4f7f09ae7d51a59d1  (Argusbio)
http://www.genetictechnologies.com.au/index_general.asp?menuid=040.010 (Australian DNA tests)
http://www.familygenetics.co.uk/  (Family Genetics)
http://www.whatman.com/products/?pageID=7.31.31  (DNA storage cards)*****
http://www.preventiongenetics.com/resgeno/researchgeno.htm (Specialist types of DNA testing etc)
http://www.eyeondna.com/2007/06/21/dna-testing-in-the-czech-republic/  (Czech DNA companies- prices in the article are misleading, it seems only 12 markers are tested, and services are limited.)
http://money.cnn.com/news/newsfeeds/articles/prnewswire/NYF01016112007-1.htm  (deCODEme- to test 1 million base sections of DNA for SNPs)
http://www.decodeme.com/  (deCODEme)
{{
http://members.aol.com/dnacousins/deCODEme_Compare_Genomes.zip deCODEme comparisons example}}
http://www.rootstelevision.com/players/player_dna.php?bctid=1351299777  (explanation of deCODEme test)
https://www.23andme.com/ourservice/ancestry/science/  (23andme)
http://dnacousins.com/SNPs_on_Chips.xls
http://www.techcrunch.com/2008/03/02/my-23andme-dna-results/  (example of 23andme results)
https://www.23andme.com/user/signup/  (demo account for 23andme)
http://www.knome.com/  (Full genome sequencing)
http://www.genomics.org.cn/bgi/english/index.htm#  (Beijing Genomics Institute)
http://www.familybuilder.com/   (NO LONGER OPERATING)
http://www.geni.com/
http://www.nytimes.com/2008/10/06/business/06gene.html?_r=1&ref=business&oref=slogin (Low Price full Genome DNA sequencing technologies.)
http://www.prnewswire.com/cgi-bin/stories.pl?ACCT=ind_focus.story&STORY=/www/story/11-03-2008/0004916773&EDATE=MON+Nov+03+2008,+06:05+AM  (full genome sequencing)
http://www.pathway.com/
http://www.nimblediagnostics.co.nz/CC25759E002852C8/about/anc  (Nimble diagnostics, New Zealand)
http://genofond.binec.ru/default2.aspx?s=0&p=23
http://www.myancestorsgenes.com/order.php  (Australian test company)
www.completegenomics.com  (Full genome sequencing)
 

Forensic and ancient DNA laboratories

 


Genealogical DNA testing available in Johannesburg, South Africa:
PO Box 1038, Human Genomic Diversity and Disease Unit, School of Pathology, Wits, NHLS, Johannesburg, South Africa, 2000

DNA Storage:
Since I have been running the Marsh DNA Project, I have been contacted by a number of Marsh descendants who have no male line relatives living.  In some cases, the last male line relative had recently died, and the options for getting samples for DNA testing are no longer available. I suggest that if there is a single direct male line Marsh relative in your family, that you might consider finding a way to get DNA stored for testing in the future.  If they are very elderly, it might also suggest obtaining DNA samples should be considered in the near future.  Most test companies store DNA for free, itfa test is purchased from their company.  Some will process and store DNA for a relatively small fee.  An alternative is also simple storage kits which can be purchased to enable DNA of relatives to be stored in your own home, so that you have freedom to get testing done at any test company in the future.  As DNA science is rapidly advancing, who can say the exciting opportunities we may have in the future, for learning about our family origins with DNA.  If DNA is stored, it is a cheap insurance policy which enable future testing. 

http://www.thegeneticgenealogist.com/2007/08/28/dna-from-the-dead-dna-banking-is-legal-but-is-it-ethical-part-i/  (DNA Storage)
http://www.preventiongenetics.com/  (Method for good quality long term DNA storage.)***
http://dnaaction.com/usa/dna-preservation.asp  (DNA Preservation Service)
http://preventiongenetics.com/  (DNA Storage using Blood)
http://www.thegeneticgenealogist.com/?s=DNA+Banking&x=15&y=8 (DNA Banking)
http://www.dnadirect.com/patients/tests/dna_archive_storage/index.jsp (DNA Direct home storage system for DNA)
http://archiver.rootsweb.com/th/read/genealogy-dna/2007-04/1177326061 (Discussion of FTA cards)
http://archiver.rootsweb.com/th/read/genealogy-dna/2007-04/1177326061 (Comparing DNA storage systems)
http://www.whatman.com/FTANucleicAcidCollectionStorageandPurification.aspx

DNA Consultants & related services:
http://www.isogg.org/consult.htm  (DNA Consultants & related services)

DNA accessories:
http://www.dnapin.com/  (If you have been DNA tested, and have learned which DNA "haplogroup" you are a member of, you can purchase pins to wear which show your haplogroup)
http://home.comcast.net/~libpjr1/dnapins.htm   (Haplogroup pins etc.)
http://www.dna-fingerprint.com/modules.php?op=modload&name=Downloads&file=index&req=viewdownload&cid=2   (Omnipop spreadsheet.)
http://www.dna-rainbow.org/ ("DNA rainbow" perhaps interesting, but not strictly useful for genealogy)

Glossary of DNA terms:
http://www.kerchner.com/dna-info.htm   (Glossary, use "Genetic Genalogy Glossary" link second line on page)
http://edmund-rice.org/dnagloss.htm   (Glossary of DNA terms)
http://www.contexo.info/DYSYCAII.htm (Technical information.)
http://www.genomatix.de/online_help/help/sequence_formats.html  (DNA Sequence formats)

DNA is cost effective research:
http://www.familytreeDNA.com/facts_genes.asp?act=show&nk=2.9   (DNA costs compared to alternatives)

Interpretation of results:
http://www.davidkfaux.org/dnaprofile2   (example of one person's interpretation of his results for haplotype R1b)

About Haplogroups: 
http://www.timjanzen.com/dna.html  (for calculating ages of haplogeoups)
http://ytree.morleydna.com/ExperimentalGenoPhylogeny.pdf  Haplotree with new SNPs#######
http://dgmweb.net/DNA/General/Y-DNA_modal_haplotypes.html#G (haplogroup modals)
http://ytree.ftdna.com/   (Y-Tree)******
http://www.kerchner.com/haplogroups-ydna.htm (Haplogroup descriptions)
http://www.familytreedna.com/PDF/2008-HaploChart_GR_lores.pdf  ***** (Haplotree-FTDNA)
http://isogg.org/tree/  (Haplotree... note there are different versions)  *****  (Haplotree-ISOGG)
http://dna-forums.org/index.php?showtopic=1274&hl= (Y-DNA Haplotree)
http://www.eupedia.com/europe/origins_haplogroups_europe.shtml#R1b
http://dgmweb.net/genealogy/DNA/SNPcharts/R1b_2009-03-19.shtml  (Haplotree comparisons)
http://www-ab.informatik.uni-tuebingen.de/software/dendroscope/welcome.html (Phylogenic tree software- free) {{note see http://www.vizachero.com/R1b1/R1bSplits.png for an example of a network tree using this software... the suggestion is the software is easy to use.}}
http://nexus.ugent.be/geert/ (Tree illustrator)
http://splitstree.org/  (Phylogenic tree software- free)
http://members.bex.net/jtcullen515/HaploTest.htm
http://www.worldfamilies.net/y-haplogroups.htm   (Haplogroups)
http://www.eupedia.com/europe/origins_haplogroups_europe.shtml  (age of haplogroups)?????
http://www.hprg.com/hapest5/  (Haplogroup predictor programme)******
http://freepages.genealogy.rootsweb.com/~geneticgenealogy/  (useful information about haplogroup, clustering, markers etc)****
http://freepages.genealogy.rootsweb.com/~dgarvey/DNA/RelGen/Butler_YCC_samples.htm  (Typical haplotypes representing haplogroups)
http://members.bex.net/jtcullen515/temptable.html  (Modal Haplotypes for Haplogroups)
http://ycc.biosci.arizona.edu/nomenclature_system/table1.html (Geographic/ Ethnic origins of haplogroups)
http://www.scs.uiuc.edu/~mcdonald/WorldHaplogroupsMaps.pdf  (Y-haplogroups of Europe, distibution map)

http://freepages.genealogy.rootsweb.com/~dgarvey/DNA/RelGenMarkers.htm
http://freepages.genealogy.rootsweb.com/~dgarvey/DNA/markers.htm
http://freepages.genealogy.rootsweb.com/~dgarvey/DNA/Underhill_2003.html
http://ycc.biosci.arizona.edu/nomenclature_system/frontpage.html   (Nomenclature System for Haplogroups)
http://freepages.genealogy.rootsweb.com/~dgarvey/DNA/RelGen/YCC.html   (New Haplogroup system)
http://www.le.ac.uk/genetics/maj4/JoblingTS.03.NRG.Review.pdf   (New Nomenclature for R1b Haoplogroup- GOOD)
http://www.maik.ru/eng/online/index.htm   (about haplogroup R1a in Eastern Europe)
http://baz.perlmonk.org/haplogroups.jpg   (Haplogroup map of Europe)
http://freepages.genealogy.rootsweb.com/~dgarvey/DNA/y_bosch.htm   (Modal STR alleles for haplogroups)
http://freepages.genealogy.rootsweb.com/~dgarvey/DNA/RelGen/YSTR.htm (Modal STR alleles for haplogroups)
http://www.roperld.com/YBiallelicHaplogroups.htm   (Timetable of haplogroup markers- GOOD)
http://www.racearchives.com/calc/haplo_data.asp?dbname=ychroms   (Human races calculator- uses old haplogroup names)
http://ybase.org/statistics.asp   (Frequency of DYS nos, typical haplotypes within haplogroups)
http://smgf.org:8081/pubgen/site15.jsp (Frequesncy of DYS numbers in Sorensen study etc)
http://www.familytreedna.com/pdf/ZeguraMBE2004.pdf
http://evolutsioon.ut.ee/publications/Cinnioglu2004.pdf
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=56946  
http://hpgl.stanford.edu/publications/AJHG_2003_v72_p281-302.pdf
http://hpgl.stanford.edu/publications/HG_2000_v107_p582.pdf
http://www.journals.uchicago.edu/AJHG/journal/issues/v70n1/013099/013099.text.html
http://www.dienekes.com/blog/archives/000532.html
http://hpgl.stanford.edu/publications/AJHG_2001_v68_p432.pdf
http://www.journals.uchicago.edu/cgi-bin/embpcgi.pl/cgi-bin/res-page.epl?objid=316949 (Australian/ Melanesian)
www.cshl-symposium.org/doi/pdf/10.1101/sqb.2003.68.487
http://dienekes.blogspot.com/  (Includes modal haplotypes for different regions)
http://www.geocities.com/prooferjoan/R1b.htm (Common R1b haplotype distributions)
http://home.earthlink.net/~wilsondna/FILE_DOWNLOAD_PAGE.htm   (Includes file of R1b haplotypes)
http://www.geocities.com/mcewanjc/p3origin.htm (Haplogroup distribution analysis by John McEwan- interesting)***

http://www.geocities.com/null439/Dist2.htm (Allele values in different haplogroups)
http://freepages.genealogy.rootsweb.com/~ncscotts/Y-DNA/Oppenheimer%20Clan%20Test.htm Oppenheimer Clan Test Results.
http://www.genebaze.cz/cgi-bin/ydmarmod.cgi?lang=us&n=cz (Modal values Czech DNA Project)
https://www3.nationalgeographic.com/genographic/atlas.html (NG Atlas of the human journey)
http://www.ethnoancestry.com/info.html  (Links to info on haplogroups)
http://www.kerchner.com/haplogroups-ydna.htm (Brief description of haplogroup origins)
http://freepages.genealogy.rootsweb.com/~jswdna/haplogroupvalues.htm   (Modal haplotypes for haplogroups)
http://www.dna-fingerprint.com/user.php?op=userinfo&uname=HUGO (Hugo reference sequence)
A Haplogroup:  
http://www.nature.com/ejhg/journal/v15/n3/abs/5201771a.html

B Haplogroup:
C Haplogroup:        
E Haplogroup:
http://www.haplozone.net/e3b/project/loadview/15   (E Haplogroup Modals)  
http://www.haplozone.net/e3b/project    
https://docs.google.com/spreadsheet/ccc?key=0Au_yP14v4kTIdEQ5UnptSnRkWlBGX0l5Z2ZJbHVRb0E&hl=en_US#gid=0 (E haplogroup SNPs)
http://maps.google.com/maps/ms?ie=UTF8&hl=en&msa=0&msid=105754639437185730882.00044a5cd3d6919bb64a5&ll=39.504041,-12.832031&spn=28.784698,59.414063&t=p&z=4
 (Distribution map of E3b in Iberia)
http://dna-forums.org/index.php?showtopic=4327
Data pages: http://www.haplozone.net/e3b/project
Discussion group: http://community.haplozone.net
Wiki: http://www.haplozone.net/wiki/index.php?title=Main_Page
http://community.haplozone.net/
F Haplogroup:
http://www.familytreedna.com/public/F-YDNA/
G Haplogroup:
http://www.members.cox.net/banksfamilies/67markernetwork.html
H Haplogroup:
https://www.familytreedna.com/public/YHaploGroupH
I Haplogroup:  
www.northwestanalysis.net  (I haplogroup) 
http://www.goggo.com/terry/HaplogroupI1/
http://knordtvedt.home.bresnan.net/
http://freepages.genealogy.rootsweb.com/~geneticgenealogy/I67y.gif  (I haplogroup clusters, 67 markers)
http://www.familytreedna.com/(voke2055jc3g2i55hm2yfbih)/public/yDNA_I1a/index.aspx  (I1a project)
http://www.familytreedna.com/public/I1b2HapGroup/index.aspx  (I1b2 project)
http://tinyurl.com/2b76jd  (I1b2* project)

http://www.familytreedna.com/public/I1c-Y-Clan/index.aspx  (I1c project)
http://docs.google.com/View?docid=dg8hv2jm_3d8qnqz 
(Old I1c)
http://listsearches.rootsweb.com/?list=Y-DNA-HAPLOGROUP-I (Y haplogroup mailing list)

http://www.geocities.com/prooferjoan/I1a.htm (Common I1a haplotype distributions)http://www.geocities.com/vetinarilord/hapi.pdf   (Haplogroup I- Rootsi study)
www.northwestanalysis.net  (Haplogroup I web page- Nordvelt)
http://www.gslt.hum.gu.se/~leifg/jh/
(I haplogroup analysis)
J Haplogroup:  
http://www.j2-ydnaproject.net/ie7.html  (J2 Project)   
http://www.ftdna.com/pdf/HaploJ.pdf   (Haplogroup J study) 
http://j1bm365.blogspot.com/
K Haplogroup:       
Q Haplogroup:
http://www.familytreedna.com/(y5gvf13owg4upl45usam0q45)/public/yDNA_Q/index.aspx  (Q Haplogroup Project)
www.qydna.org  (Q Haplogroup Project)

http://www.qydna.org/g3yhrd.xhtml  (Q haplogroup results)
Q Haplogroup modal haplotypes
shown on Y-Search are as follows...
2Q5V7 The Jewish (Ashkenazi) Y-DNA-Q modal haplotype.
BE9R2 The Native American Y-DNA-Q modal haplotype.
F5F44 The Old Norse Y-DNA-Q modal haplotype.
THZ96 The Y-DNA-Q Security modal haplotype.  (most Qs are within 3 steps of this haplotype)
http://www.freewebs.com/ydna_q/  (Q haplogroup project)    
http://www.genebase.com/tutorial/item.php?tuId=16 
(Haplogroup Q)
R Haplogroup:   
Note, the "naming" of subclades of R is continually changing, and some of the headings below have been superseded. 
http://dgmweb.net/genealogy/DNA/SNPcharts/ISOGG-FTDNA_HapR_2009.shtml
   
http://www.eupedia.com/europe/origins_haplogroups_europe.shtml#R1b   
http://www.eupedia.com/europe/Haplogroup_R1b_Y-DNA.shtml

R1* Haplogroup Y-DNA Project

http://www.familytreedna.com/public/R1Asterisk

R1a Haplogroup Y-DNA Project

http://www.familytreedna.com/public/R1aY-Haplogroup

R1b and Subclades yDNA Haplogroup Project

http://www.familytreedna.com/public/r1b

R1b (Jewish) Project http://www.familytreedna.com/public/JewishR1b

R1b1* DNA Project http://www.familytreedna.com/public/R1b1Asterisk

R1b1b1 Haplogroup Project http://www.familytreedna.com/public/R1b1b1

R1b1b2 (Legacy ht35) Y-DNA Project

http://www.familytreedna.com/public/ht35new/default.aspx

R1b1b2a1a (formerly R1b1c9) (S21/U106+) Research Group

http://www.familytreedna.com/public/U106

R1b1b2a1a1 - S29 (aka U198) Y-DNA Project

http://www.familytreedna.com/public/U198

R1b1b2a1a3 (R1b - S26/L1) Null439 Project

http://www.familytreedna.com/public/null439

R1b1b2a1b (formerly R1b1c) rs34276300+ Project (P312/S116+) http://www.familytreedna.com/public/atlantic-r1b1c

R1b1b2a1b (DYS 464Xccgg Project)

http://www.familytreedna.com/public/DYS464x%20ccgg

R1b1b2a1b2 (R-M153) Y DNA project

http://www.familytreedna.com/public/R-M153_The_Basque_Marker

R1b1b2a1b3 (formerly R1b1c6) (SRY2627+) Project

http://www.familytreedna.com/public/R1b1c6

R1b1b2a1b4 (formerly R1b1c10) (U152+) Project http://www.familytreedna.com/public/r1b1c10

R1b1b2a1b4 (R1b1b2h/U152/S28) Project http://www.cerbere.ca/S28

R1b1b2a1b4 (formerly R1b1c10) Haplotypes http://www.davidkfaux.org/R1b1c10_Data.htm

R1b1b2a1b6 (R-L21/S145+) project

http://www.familytreedna.com/public/R-L21

R1b1b2a1b6b (R-M222) (formerly R1b1c7) Haplogroup Project

http://www.familytreedna.com/public/R1b1c7

R2 Haplogroup Y-DNA Project http://www.familytreedna.com/public/R2

 

   1. http://www.familytreedna.com/public/r1b
   2. http://www.familytreedna.com/public/r1b
   3. http://www.kerchner.com/
   4. http://www.kerchner.com/r1bproject/histograms/index.htm
   5. http://www.familytreedna.com/public/r1b
   6. http://www.kerchner.com/dna-info.htm

R1a:

http://www.ncbi.nlm.nih.gov/pubmed/17534642?dopt=Abstract (Ancient R1a)
http://gwozdz.org/PolishClades.html
http://www.scirp.org/journal/aa/
R1b:
http://en.wikipedia.org/wiki/Haplogroup_R1b_(Y-DNA)#R1b1b2_.28formerly_R1b1c.29
http://www.familytreedna.com/ftLogin.asp?
http://maps.google.com/maps/ms?client=firefox-a&hl=en&ie=UTF8&msa=0&msid=102956803377716741902.000459f49b2bc2c3cc27e&z=4  (R-L21 distribution map)
http://www.familytreedna.com/public/R-L21  (R-L21 project)
http://maps.google.com/maps/ms?ie=UTF8&hl=en&msa=0&msid=105486162464464051410.00044e6a01e1a2a6e7068&ll=44.840291,4.570313&spn=39.989817,155.390625&t=p&z=2
(R-P312 distribution map)
f=112http://www.ethnoancestry.com/index_files/index_data/Haplogroup_R2_Manoukian.pdf  (R2)
http://dna-forums.org/index.php?showtopic=998&pid=12295&start=0&#entry12295 (Modal haplotypes for divisions within R1b1c on Y-Search)
http://www.geocities.com/mcewanjc/r1bsnp.htm  (McEwan database or R1b SNPs)
http://www.geocities.com/mcewanjc/p3modal.htm (McEwan database of haplogroup modals etc.)
http://www.worldfamilies.net/SWAMH.html (Allele frequencies in R1b)
http://italydna.blogspot.com/2007/01/r1b-in-italy.html  (R1b in Italy)
http://www.familytreedna.com/(wxy4wl45wwghvnrvpqqu3u55)/public/r1b/index.aspx (R1b Project)
http://www.familytreedna.com/public/r1b
http://freepages.genealogy.rootsweb.com/~geneticgenealogy/R1b67y.gif  (R1b haplogroup clusters 67 markers)
http://www.geocities.com/mcewanjc/p3modal.htm#_R1b_haplogroup:_subcluster_modal_ha (Modal values for various haplogroups and haplogroup clades and clusters)***
www.northwestanalysis.net
(R1b Modals for varieties)
http://www.jogg.info/31/campbell.htm (Geographic patterns of R1b in British Isles)
http://www.jogg.info/51/files/Wright.htm Irish type III R1bs

R1b1c Irish type III cluster:
http://www.irishtype3dna.org/  (R1b1c Irish Type III cluster web site)
R1b1c4 Haplogroup:
http://www.geocities.com/mcewanjc/r1bsnp.htm  (Includes R1b1c4- a small group of 7 or more R1b1c4 haplotypes are known)
R1b1c6 Haplogroup:

R1b1c7 Haplogroup:
http://www.familytreedna.com/public/R1b1c7 (R1b1c7 Project)
www.m222.net/R1b1c7 (R1b1c7 Project)

R1b1c9 Haplogroup:
http://freepages.genealogy.rootsweb.com/~geneticgenealogy/1313.htm (Distribution map for part of R1b1c9)
http://members.aol.com/chantery/S29DNA/S29_2.html (R1b1c9b- S29)
http://www.geocities.com/mcewanjc/s21.htm   (SNP S21)
http://tech.groups.yahoo.com/group/R1b1c_U106-S21/
R1b1c10 Haplogroup:  
http://www.vizachero.com/images/R1bClades.pdf  (Distribution maps for R1b1c6, 7, 9, & 10)
http://docs.google.com/View?docID=dg8hv2jm_35wgncgf&revision=_latest&pli=1 (R1b1c10)
http://www.davidkfaux.org/LaTene_Celt_R1b1c10.pdf  (R1b1c10)
http://www.familytreedna.com/public/r1b1c10/   (R1b1c10)
http://www.cerbere.ca/S28/ (R1b1c10)

http://www.familytreedna.com/public/r1b1c10/ (R1b1c10 project)
http://docs.google.com/View?docID=dg8hv2jm_35wgncgf&revision=_latest
(R1b1c10)
R2 Haplogroup:
http://www.ethnoancestry.com/index_files/index_data/Haplogroup_R2_Manoukian.pdf

SNPs: (SNPs are very slow mutating markers which are used to define haplogroups.  It is supposed that most SNPs have mutated only once in the whole of human history, meaning that all descendants of the ancestor who had that SNP mutation, will also have the mutation, but no others will have it.)
http://daver.info/WTY/Z-Inventory.pdf  (Z series SNPs)
https://www.familytreedna.com/advanced-snp-descriptions.aspx?SNP=L176.2  (L series Y SNPs)
http://hpgl.stanford.edu/publications/NG_2000_167_Y_Markers.doc (SNP tables with tech info)
http://freepages.genealogy.rootsweb.com/~dgarvey/DNA/RelGen/Butler_YCC_samples.htm ('20 Marker haplotypes for worldwide YCC samples')
http://www.dna-fingerprint.com/static/FTDNA-Conference-2007-WalkOnY.pdf  (Search for Y SNPs- presentation at FTDNA conference 2007)
http://www.cstl.nist.gov/biotech/strbase/pub_pres/Butler2003b.pdf   (STR & SNPs Butler article)
http://isogg.org/tree/ISOGG_YDNA_SNP_Index.html (ISOGG Y-DNA SNP List)
http://groups.yahoo.com/group/DNA-ANTHROGENEALOGY/database?method=reportRows&tbl=3   (SNP Names database)
http://archiver.rootsweb.com/th/read/GENEALOGY-DNA/2006-01/1137428043 (Simple technical description of a SNP)
http://www.ncbi.nlm.nih.gov/projects/SNP/  (Database where SNPs are recorded)
http://www.allsnps.com/snpbrowser  (SNP browser- it has been suggested using a firewall on this site.)
http://www.davidkfaux.org/dnaprofile2.html  (Speculated origins of a family with SNP S28+)
http://home.cfl.rr.com/wade3/S21%20and%20R1b%20group%20compared%20081206.xls (S21+ modals)
http://www.snp-y.org/  (SNP-Y Database)
http://daver.info/ysub/  (Y-Chromosome genome comparison)
 
STRs: (STRs are the DNA markers which are mostly tested in surname projects.)
http://freepages.genealogy.rootsweb.ancestry.com/~geneticgenealogy/yfreq.htm  (Allele frequencies in different haplogroups)
http://spreadsheets.google.com/pub?key=pUnr6rAB3u4lLJBq9_6t1Uw (Test company calibration adjustments)*****
http://www.cstl.nist.gov/biotech/strbase/STRseq.htm  (Sequencing of unusual STRs)*****
http://www.dna-fingerprint.com/modules.php?op=modload&name=Downloads&file=index&req=viewdownload&cid=2 (several useful tools, including marker distributions around the World, and Palindromic region diagrams)
http://www.cstl.nist.gov/div831/strbase/pub_pres/ISFG_%20Y-STRupdate.pdf   (220 potentially useful Y-DNA markers)  *****
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1794629&rendertype=table&id=Tab2 (Variation of 50 new STRs) *****
http://www.answers.com/topic/list-of-dys-markers
(list of STR markers)
http://www.cstl.nist.gov/biotech/strbase/pub_pres/NIJposter2007_newLoci.pdf  (List of diversity of 82 markers)
http://www.kerchner.com/r1bproject/cssmarkerstats/charts.htm  (Frequency of STR allele values in R1b)*****
http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=15195656     

Haplotree etc:  (Note, this seems to be modified over time, particularly for subclades)
http://isogg.org/tree/  (ISOGG Haplotree)

http://www.familytreedna.com/haplotree.htm (Haplotree)
http://www.le.ac.uk/genetics/maj4/JoblingTS.03.NRG.Review.pdf (Includes Haplotree- takes a while to download)
http://www.rafonda.com/age.html  (Age and origin of the human species)
http://ycc.biosci.arizona.edu/nomenclature_system/frontpage.html   (Y chromosome consortium web site)
http://www.fluxus-engineering.com   (Phylogenetic genetic chart software)
http://www.cstl.nist.gov/biotech/strbase/pub_pres/Vallone2004a.pdf   (Haplotree)

Genetic distance:
http://nitro.biosci.arizona.edu/ftDNA/Distance.html#Step
http://freepages.genealogy.rootsweb.com/~gkbopp/KINNEY/Research/gendistance.htm  (Genetic distance)
http://www.mymcgee.com/tools/index.html   (Software to produce a table to compare genetic distance)
http://www.familytreedna.com/GDRules_37.html   (37 markers, interpreting "relatedness" from genetic distance)
http://www.mymcgee.com/tools/index.html   (Genetic distance grid software)
http://www.mymcgee.com/results.html#geneticdistance   (Genetic distance calculator)

ASD:
http://dna-forums.org/index.php?showtopic=343&hl= (37 marker ASD calculator)
http://users.telenet.be/callmewimpy/67ASD.xls (67 marker ASD calculator)
http://users.telenet.be/callmewimpy/links.htm  (ASD calculator on this web site)

Mutation rates: (see also at the very bottom of this page)
http://worldfamilies.net/marker.htm   (Mutation rate data)*****
http://www.worldfamilies.net/marker.htm

http://hpgl.stanford.edu/publications/AJHG_2004_v74_p000-000.pdf   (technical article)
http://www.journals.uchicago.edu/cgi-bin/resolve?AJHG991495PDF   (Mutation study, father son pairs. by Kayser)
http://www.kerchner.com/dnamutationrates.htm   (Mutation rate overview)
http://www.kerchner.com/cgi-kerchner/ystrmutationrate.cgi   (Mutation rate log)
http://searches2.rootsweb.com/cgi-bin/ifetch2?/u1/textindices/G/GENEALOGY-DNA+2005+548812243546+F (Mutation rates- Chandler)

Time to "Most Recent Common Ancestor" (MRCA)
# NOTE:  all of the following give very approximate assessments, because variables such as what generation time you chose to apply, what average mutation rate you use, and whether "fast" or "slow" markers mutate, has a big bearing on "conclusions".  Even then, the "possibility range" will encompass a very large time frame between 5% and 95% probability expectations.   Sometimes one or two known facts can greatly narrow down the range of possibilities.  The pattern of which markers have mutated in comparrison to other family members is a big help.   That is why the more family members tested, particularly distant cousins, makes it easier to interpret results.  TMRCA calculations taken alone for comparing two individuals should not be taken too seriously.  They do have a value when considered in conjunction with other evidence.
http://www.tropie.tarnow.opoka.org.pl/Table-FTM.pdf
http://www.tropie.tarnow.opoka.org.pl/Table-FTM.pdf (TMRCA-<<<<<<<<<<*****)
http://www.dnacalculator.org/tmrcaCalculator.php
http://nitro.biosci.arizona.edu/ftdna/TMRCA.htm
http://members.aol.com/dnafiler/MutationCalculator.exe   (Anne Turner's Time to MRCA calculator)*****
http://www.dnacalculator.org/tmrcaCalculator.php  (Genebase TMRCA calculator)******
http://dna-project.clan-donald-usa.org/tmrca.htm  (TMRCA Calculator)
http://www.bearport.org/Downloads/MRCAChart-b.4.zip   (alternative Time to MRCA calculator)
http://blairgenealogy.com/dna/markers.html   (Marker analysis)***
http://blairgenealogy.com/dna/FTDNATiP.html
http://nitro.biosci.arizona.edu/ftDNA/Distance.html   (Genetic distance calculations)
http://www.cottrellweb.com/dna/mrca-12.htm   (probabilies re TMRCA for 12 markers)
http://www.cottrellweb.com/dna/mrca-25.htm   (probabilies re TMRCA for 25 markers)
http://www.cottrellweb.com/dna/mrca-37.htm   (probabilies re TMRCA for 37 markers)
http://www.cottrellweb.com/dna/mrca-43.htm   (probabilies re TMRCA for 43 markers)
www.moseswalker.com/mrca/calculator.asp   (MRCA calculator)
http://www.moseswalker.com/mrca/calculator.asp?q=1 (MRCA calculator)
http://www.bartondna.info/Software/MRCAChart-b.4.zip (MRCA calculator)
http://www.genetics.org/cgi/reprint/158/2/897.pdf  (Estimating TMRCA, technical article, Walsh)
http://users.telenet.be/callmewimpy/TMRCA-Calculator.xls  (TMRCA calculator)
http://dna-project.clan-donald-usa.org/tmrca.htm (TMRCA calculator-McDonald)*****
http://dna-project.clan-donald-usa.org/tmrca.htm

DNA evidence of migration events/ Ethnic genealogy/ Regional distribution of haplogroups etc:
http://people.musc.edu/~geesey/GeneticGenealogy.htm  (Human migrations)
http://vetinarilord.blogspot.com/   (Using genetic research to follow human migration patterns.)
https://www3.nationalgeographic.com/genographic/atlas.html  (National Geographic Human Migration Maps- with video)
http://mappemonde.mgm.fr/num11/articles/art06306.html (Map with distribution of populations in Europe during last Ice Age)
http://my.opera.com/macedonians/blog/2008/01/29/the-late-glacial-ancestry-of-europeans (
The Late Glacial ancestry of Europeans: Combining genetic and archaeological evidence)
http://arheologija.ff.uni-lj.si/documenta/pdf33/gamble33.pdf  (
Late Glacial ancestry of Europeans)
http://www.eurekalert.org/pub_releases/2008-02/plos-hin021108.php (Ancient migration to America)
http://class.csuhayward.edu/faculty/gmiller/3710/dnarefs.html  (Ancestral DNA references)
http://www.bbc.co.uk/history/programmes/bloodofthevikings/genetics_results_01.shtml  (Viking genetic survey results)
http://mbe.oupjournals.org/cgi/content/full/19/7/1008   (Y Chromosome Evidence for Anglo-Saxon Mass Migration)
http://dienekes.blogspot.co.nz/2012/02/thomas-tartaron-lecture-on-otzi-iceman.html  (Ice man video lecture)
http://thescotsman.scotsman.com/index.cfm?id=1393742006 (Origins of people of British Isles- Sykes)
http://www.davidkfaux.org/dnaprofile2z.html   (Y-DNA research articles/ Iceland/ Norway/ Anglo Saxon)
http://www.newswriting.net/ID82.htm   (Links to ethnic genealogy webs sites)
http://www.historicalgenetics.com/Clusters.html   (regional distribution study of specific markers)
http://www.le.ac.uk/genetics/maj4/JoblingTS.03.NRG.Review.pdf   (Includes regional distribution of haplogroups- takes a while to download)
http://www.davidkfaux.org/shetlandislandsY-DNA2Rev.html   (Shetland DNA study)

http://www.galwayadvertiser.ie/dws/story.tpl?inc=2005/03/17/news/56881.html<http://www.galwayadvertiser.ie/dws/story.tpl?inc=2005/03/17/news/56881.html   (Irish surnames DNA study)
http://ealerts.nature.com/cgi-bin24/DM/y/ebN50Sn1nD0Hh40BGQZ0EG (Scale of Viking settlement of Ireland, based on Y-DNA study)
http://home.comcast.net/~libpjr1/bahamasdna.html   (Bahamas DNA Study)
http://www.davidkfaux.org/dnaprofile2z   (Articles- Celtic, Anglo - Saxon, Jute, Danish Viking, Norse Viking)
http://www.nature.com/ejhg/journal/vaop/ncurrent/extref/5201651x2.xls (Y-DNA Sweden)
http://www.german-dna.net/  (German Heritage DNA)
www.frenchdna.org  (French DNA Project)
http://www.familytreedna.com/public/WalesDNA/index.aspx  (Welsh DNA Project)
http://www.familytreedna.com/public/benelux/  (Belgium/ Netherlands/ Luxemburg DNA)
http://news.bbc.co.uk/1/hi/wales/1256894.stm (Y-DNA link Celts, Irish,  and Basques)
http://dienekes.blogspot.com/2005/12/y-chromosomes-of-norway.html   (Y chromosome in Norway)

http://icliverpool.icnetwork.co.uk/0100news/0100regionalnews/content_objectid=13718050_method=full_siteid=50061_headline=-Viking-past-proved-by-new-tests-name_page.html (Viking DNA)
http://www.nature.com/cgi-taf/DynaPage.taf?file=/hdy/journal/vaop/ncurrent/full/6800661a.html (Viking DNA)
http://www.ftdna.com/public/vikingydna/   (Viking DNA Project)
www.brigadoon.net/scottishdna.htm   (Scottish Clans DNA)
www.scottishdna.net  (Scottish Clans DNA)
http://www.calabriadna.com  (Calabrian DNA study)
http://www.greekdnaproject.net/ydna.gif  (Greek DNA Project)
http://www.dnaheritage.com/masterclass2.asp   (Human migration maps)
http://www.familytreedna.com/DNAPrintRes/map.pdf   (Human migration routes)

http://news.nationalgeographic.com/news/2002/12/photogalleries/journey_of_man/popup2.html (Migration roots)
http://news-info.wustl.edu/tips/page/normal/6349.html   (Out of 3x Africa theories)
http://www3.interscience.wiley.com/cgi-bin/fulltext/112221248/PDFSTART   (Out of 3x Africa theories full article)
http://hpgl.stanford.edu/publications/Examining_2003_chapter6.pdf.   ("Inference of Neolithic Population Histories using Y-Chromosome Haplotypes"- may take a while to download)
http://www.nottingham.ac.uk/~sczsteve/survey.htm   (Genetic Survey of Wirral and West Lancashire- Viking DNA)
http://www.broad.mit.edu/media/archive/pr_01_drlinkage.html (SNP's and human population history)
http://www.eurekalert.org/pub_releases/2003-05/su-sud052703.php   (Population expansion Europe 25,000 years ago)
http://www.journals.uchicago.edu/cgi-bin/resolve?AJHG024787PDF (Population expansion Europe 25,000 years ago)
http://news.bbc.co.uk/1/hi/uk/3618613.stm   (Openheimer theory- Anglo/ Scottish split)
http://www.newscientist.com/news/news.jsp?id=ns99994586   (not a DNA article, but covers past 40,000 in Europe)
http://www.sciencedaily.com/releases/2004/01/040122082842.htm   (Tracking human migration with DNA)
http://www.tracegenetics.com/Eshlemanetal2003.pdf   (Migration to the Americas)
http://www.familytreedna.com/pdf/ZeguraMBE2004.pdf   (Y chromosome of Native Americans)
http://freepages.genealogy.rootsweb.com/~dgarvey/DNA/Paracchini.htm (Y-Haplogroups California/Hawaii)
http://www.bauuinstitute.com/Articles/JonesmtDNA.pdf   (Native American Demographic History & DNA)
http://www.ismmed.org/VWCMM_Abstracts_Late.htm   (Native American)

http://www.nature.com/cgi-taf/DynaPage.taf?file=/ejhg/journal/v11/n7/abs/5200992a.html (Croatian Y-DNA)
http://anthro.palomar.edu/vary/vary_3.htm (Map of blood group distribution- not DNA, but a related issue)
http://groups.yahoo.com/group/thelasticeage/ (Message group- humans during the last ice age)  "In the Iberian Peninsula it appears that only three haplogroups survived that harsh 2,000? year period about 20,000 years ago (Y-chromosome R1b and mtDNA V and H - Bryan Sykes' Velda and Helena).    The Italian and Balkan Peninsulas managed to only support Y-chromosome I and mtDNA T and K (Tara and Katrine). The steppe to the east of the Black Sea was home to Y-chromosome R1a and mtDNA X (Xenia which includes I - Bonnie Schrack's Iris). In the Fertile Crescent of the Middle East lived Y-chromosome G and ? and mtDNA J (Jasmine) and ? To learn more about this period in Europe and the rest of the world, I've started a a collaborative project to provide Web resources about humans and their environment during the Last Glacial Maximum."
http://www.pnas.org/cgi/reprint/98/1/22.pdf (Genetics and the population history of Europe)
http://www.cohen-levi.org/jewish_genes_and_genealogy/jewish_genes.htm (Cohen-Levi DNA, Jewish DNA study)
http://www.davidicdynasty.org/ (Davidic Dynasty- DNA study)
http://news.yahoo.com/s/ap/20070705/ap_on_re_eu/hidden_holocaust
http://www.khazaria.com/genetics/abstracts-cohen-levite.html (Jewish Genetics: Abstracts and Summaries)

http://www.journals.uchicago.edu/AJHG/journal/issues/v69n5/013033/013033.html   (Jewish DNA)
http://www.pnas.org/cgi/content/full/97/12/6769   (Jewish DNA)
http://www.calvarysac.org/genetic.html (Judy Siegel. _"Genetic link  found among 'kohanim'.")
http://www.familytreedna.com/nature97385.html   ("Y Chromosomes of Jewish  Priests.")
www.gnxp.com/MT2/khazar.pdf   (Ashkenazi R1a results.)
http://www.gnxp.com/MT2/khazar.pdf   (Ashkenazi/ Khazar)
http://home.earthlink.net/~djmill/fcdna.html"http://home.earthlink.net/~djmill/fcdna.html    (French Canadian DNA)
http://www.guardian.co.uk/comment/story/0,3604,926038,00.html (DNA of black African Jews- Lemba tribe)
http://www.ucl.ac.uk/tcga/tcgapdf/Weale-HG-01-Armenia.pdf   (Armenian DNA)
http://archiver.rootsweb.com/th/read/GENEALOGY-DNA/2003-10/1065451895 (Distribution of haplotype I)
http://www.geocities.com/vetinarilord/hapi.pdf   (Haplogroup I)
http://www.historicalgenetics.com/Clusters.html   (Identification of population clusters using heirachical clusters based on Y-STR distribution profiles)
http://africanancestry.com/  (African DNA)
http://www.comanchelodge.com/cherokee-blood.html   (Cherokee DNA studies/projects)

http://story.news.yahoo.com/news?tmpl=story&cid=585&e=1&u=/nm/20040906/sc_nm/science_migrations_dc (First Americans from Australia?)
http://www.cbc.ca/stories/2003/10/28/inuit_blond031028   (Icelandic/ Inuit DNA)
http://www.lifesciencesnetwork.com/news-detail.asp?newsID=1381Icelandic   (Icelandic DNA, clues to human genetic code)
http://www.planetsave.com/ViewStory.asp?ID=2620   (History of Icelandic DNA project)
http://home.comcast.net/~libpjr1/haplogroupI.htm   (Haplogroup I & R1b- a description of origins)
http://www.racearchives.com/archived/archived.asp?sectionID=805965602398   (Human races archives)*
# Note:  examples of origins of haplogroups...  Haplogroup is a ancestral genetic population indicator:..e.g. R1b is from the European Atlantic Coastal area; R1a is from the Russian Steppes; Q is Central Asian-Amerindian; G is a India, Pakistan; and H is India, Sri Lanka, Pakistan.
http://www.small-stuff.com/WELSH/ (Welsh DNA Study)
http://www.familytreedna.com/public/WalesDNA/index.aspx  (Welsh DNA study)
http://freepages.genealogy.rootsweb.com/~wgeorge/dna/cornwall.html   (Cornish Y-DNA)
http://www.gen.tcd.ie/molpopgen/data.htm   (Irish DNA study)
http://www.familytreedna.com/pdf/Nature2000.pdf   (Y-DNA Ireland)
http://www.pnas.org/cgi/reprint/98/9/5078.pdf   (Y-DNA Ireland)
http://www.gen.tcd.ie/molpopgen/data.htm   (Irish DNA Study)

http://www.gen.tcd.ie/molpopgen/link%20files/McEvoy%20et%20al%202006%20Hum%20Gen%20Sup_Info.xls   (Irish families studied)
http://mbe.oupjournals.org/cgi/reprint/19/7/1008.pdf   (Y-DNA Ireland)
http://news.scotsman.com/scotland.cfm?id=51752005   (DNA ties of Scots to Iraq)
http://www.genetics.org/cgi/content/full/160/1/289   (Polynesan DNA)
http://www.pnas.org/cgi/content/full/97/15/8225   (Polynesan DNA)
http://hpgl.stanford.edu/publications/AJHG_2004_v74_p000-000.pdf   (re Poynesians & Gipsies)
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=31389   (Gypsy genetics)
http://www.cmj.hr/2005/46/4/16100752.pdf   (Croations.)
http://www.debradickerson.com/articles/identity_crisis.htm   (African DNA)
http://www.ocf.org/OrthodoxPage/reading/St.Pachomius/bede1_15.html   (Bede's description of distibution of Angles, Saxons, and Jutes in England, not re DNA, but of interest in interpreting where DNA might have come from.)
http://www.stormfront.org/whitehistory/ychromo.htm   (Haplogroup trends in races/ geographic areas)
http://www.geocities.com/vetinarilord/basque1.pdf   (Basque Y-DNA)
http://www.familytreedna.com/public/Greece/  (Greek DNA)
http://www.gnxp.com/IndependentOriginsOfIndianCaster.pdf   (Indian Y-DNA)

http://dienekes.blogspot.com/2005/04/y-chromosome-lineages-from-portugal.html   (Portugal)
http://scienceblogs.com/gnxp/2010/01/european_man_the_farmer.php (Origin of Europeans)**********

Human Genome/ Technical articles about Y-DNA/ DNA testing etc:
http://www.ensembl.org/Homo_sapiens/mapview   (information on the parts of the human genome)
http://www.ensembl.org/Homo_sapiens/mapview?chr=Y (Y-Chromosome technical data)***
http://www.genome.gov/Pages/EducationKit/online.htm   (Human Genome research- includes animated tutorials)
http://jimwatsonsequence.cshl.edu/cgi-perl/gbrowse/jwsequence/  (James Watson Personal Genome sequence)
http://www.biomedcentral.com/news/20040527/01   (Chimpanzee DNA differs from Human)
http://archiver.rootsweb.com/th/read/GENEALOGY-DNA/2002-09/1032905676 (Chimpanzee Y-DNA)
http://www.nature.com/news/2005/050829/full/050829-9.html   (Full chimpanzee genome sequenced.)
http://www.nature.com/nsu/010215/010215-5.html ( "The Y Chromosome: Goldmine and Junkyard")

http://genome.ucsc.edu/cgi-bin/hgTracks?clade=vertebrate&org=Human&db=hg17&position=chrY&pix=620&hgsid=42345570&Submit=submit (Human Genome Browser)
http://human.genelynx.org/cgi-bin/record?glid=24991 (Genelynx data)
http://www.nature.com/nature/focus/humangenome/   (re articles, human genome, at Nature>)
http://www.sanger.ac.uk/Info/Press/2004/041020.shtml
http://www.sciencedaily.com/releases/2005/03/050328174826.htm (Human DNA & Primates)
http://www.cstl.nist.gov/div831/strbase/ystr_fact.htm   (Known Y-DNA STRs... DYS nos. etc.)
http://www.contexo.info/DYSYCAII.htm  (electropherograms etc.)***

http://www.dna-fingerprint.com/index.php?module=photoshare&func=showimages&fid=1 (electropherogram library)
http://www.heraldsun.news.com.au/common/story_page/0,5478,16163799%5E24331,00.html (sequencing whole genome $3m.)
http://www.smartplanet.com/technology/blog/science-scope/the-amazing-race-for-the-cheapest-and-fastest-dna-machine/220/ (New DNA sequencing technologies available)
http://www.cstl.nist.gov/div831/strbase/pub_pres/ISFG_%20Y-STRupdate.pdf   (220 potentially useful Y-DNA markers)
http://www.nytimes.com/2005/01/16/health/16cnd-gene.html?ex=1106958798&ei=1&en=a59890bdf130f014   (Fertility- longevity)
http://www.opsi.gov.uk/acts/acts2004/20040030.htm  (Human Tissue Act)
http://www.opsi.gov.uk/acts/acts2004/40030--d.htm#45  (Non-consensual analysis of DNA is at section 45)
http://www.time.com/time/magazine/article/0,9171,1541283-1,00.html (How we became human)
http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=9786153  (Human Genome database)
http://www.upi.com/NewsTrack/Science/2007/07/31/most_complete_primate_gene_study_reported/7928/
http://sciencenow.sciencemag.org/cgi/content/full/2007/730/4
http://www.ingentaconnect.com/content/bsc/jfo/2007/00000052/00000001/art00008 (DNA extraction from hair)
http://www.eurekalert.org/pub_releases/2007-12/pb-tip122707.php  (Human evolution & DNA)
http://arxiv.org/PS_cache/cond-mat/pdf/0601/0601394v2.pdf  (Future possibility for DNA testing whole genomes quickly)
http://www.dna-fingerprint.com/static/PalindromicRegion-V2.pdf (map of palindromic region, relevant to RecLOH events)
http://www.technologyreview.com/Biotech/20640/   (Future possibilities for cheap DNA testing)
http://www.foresight.org/nanodot/?p=2919   (Future possibilities for cheap DNA testing)
http://scienceblogs.com/geneticfuture/2009/02/oxford_nanopore_making_progres.php   (High speed testing)
http://yh.genomics.org.cn/   
http://www.scientificblogging.com/philosophical_scientist/dna_probability_and_fallacy
http://www.forbes.com/2010/01/12/genome-illumina-sequencing-business-healthcare-cancer-autism.html
http://www.genomeweb.com/sequencing/complete-genomics-nears-commercial-launch-eyes-thousands-genomes-2010
http://www.completegenomics.com/news-events/press-releases/Complete-Genomics-is-Publicly-Releasing-a-Large-Sequencing-Dataset60-Complete-High-coverage-Human-Genomesfor-Study-by-the-Global-Research-Community-115157499.html  (publically available complete geneome sequences)

DNA and historic figures:
http://www.isogg.org/famousdna.htm   (DNA database of famous people) ***
http://news.bbc.co.uk/2/hi/south_asia/7525060.stm 
(Yeti DNA)
http://www.journals.uchicago.edu/cgi-bin/resolve?AJHG024530PDF  (article about Genghis Khan)
http://egweb.bcgsc.ca/journal_club/2003_2004/pdfs/short_report_031006_mongol_Y_chrom.pdf   (Mongolian DNA- Genghis Khan)
http://www.angelfire.com/va/TJTruth/   (Thomas Jefferson- there are many DNA articles on the net about Jefferson, his Y-DNA was DYS19 = 15  DYS388 =12  DYS389-1 = 12  DYS389-2 = 27  DYS390 = 24   DYS391 = 10  DYS392 = 15  DYS393 = 13)
http://www.ysearch.org/lastname_view.asp?uid=&letter=&lastname=Devereaux&viewuid=PW3G7&p=0   (Historically the Devereaux family are believed to have the same Y-DNA origins as William the Conqueror [from William's great uncle].  A DNA study has been started to try and establish the ancestral Y-DNA of the Devereaux family.  This result is for a Devereaux who does not have a confirmed line back to William I's great uncle,  but it is a step towards identifying William's Y-DNA.)
http://dsc.discovery.com/news/briefs/20040119/columbus.html   (Christopher Colombus)
http://www.nytimes.com/2007/10/08/us/08columbus.html?_r=2&hp=&adxnnl=1&oref=slogin&adxnnlx=1191859208-WfbjoYGJiDXfns94DtOQog  (Christopher Colombus)
http://news.independent.co.uk/world/science_technology/story.jsp?story=6   (Christopher Colombus)
http://www.electricscotland.com/history/articles/norse.htm (DNA of Somerled, Scottish clan chieftain circa 1100)
http://www.eurekalert.org/pub_releases/2006-01/uom-uom011706.php (Abe Lincoln)
http://jimwatsonsequence.cshl.edu/cgi-perl/gbrowse/jwsequence/  (James Watson Personal Genome sequence)
http://dna-forums.org/index.php?showtopic=4389&hl=  (DNA of famous people)

Stories about how people have used DNA in genealogy:
http://www.richmond.com/locallife/output.cfm?ID=2777655&vertical=LocalLife
http://jgg-online.blogspot.com/
http://www.nytimes.com/2007/03/14/arts/14reun.html?_r=1&oref=slogin (West family)
http://www.aconews.com/articles/2007/08/08/noc/news/news18.txt  (Berry family)
www.theday.com/re.aspx?re=e8a3a0de-cdd1-4059-9cca-401853e35927
http://www.timesonline.co.uk/tol/news/uk/science/article2753556.ece
http://www.nytimes.com/2006/01/22/weekinreview/22harmon.html?_r=1&n=Top/Reference/Times%20Topics/People/H/Harmon,%20Amy&pagewanted=all&oref=slogin

DNA from ancient sources:
NOTE: Paavo at the Max Planck institute in Germany is the leader in this area now and he is making some exciting predictions.
http://www.nature.com/nature/journal/v463/n7282/pdf/nature08835.pdf  (Ancient 4000 year old Saqqaq genome Q1a)
http://www.cbs.dtu.dk/cgi-bin/saqqaq.cgi   (Saqqaq genome on line)

http://dienekes.blogspot.com/2008/05/ancient-y-chromosome-studies.html ***
http://www.npr.org/templates/story/story.php?storyId=13890656&ft=1&f=1007  (Ancient DNA from spit)
http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0002214#pone.0002214.s003 (ancient DNA 1000 to 2000 Years Old)
http://www.isogg.org/ancientdna.htm (Ancient DNA)
http://dienekes.blogspot.com/2005/03/ancient-dna-compendium.html   (Ancient DNA Compendium)
http://www.donsmaps.com/index.html  (Information about ancient archaeology)
http://dsc.discovery.com/news/briefs/20040621/bison.html (DNA from ancient hair- including Isaac Newton)
http://www.abc.net.au/science/news/stories/s1158845.htm   (Bronze age)

http://www.khaleejtimes.com/Displayarticle.asp?section=theuae&xfile=data/theuae/2004/december/theuae_december568.xml (7,500 year old DNA)
http://www.cr.nps.gov/archeology/kennewick/kaestle.htm  (Attempts to get DNA from Kenwick Man)
http://www.archaeology.org/online/news/dna.html   (Neanderthal DNA)
http://www.msnbc.msn.com/id/13955661/from/ET/  (Full Neanderthal DNA will be sequenced in 2 years)
http://www.sciencedaily.com/releases/2009/02/090212112731.htm (Draft Neanderthal sequence completed)
http://www.sciencenews.org/view/generic/id/34990/title/Neandertal_mitochondrial_DNA_deciphered_
http://www.nature.com/nature/videoarchive/neanderthaldna  (Video, Neanderthal DNA)
http://ealerts.nature.com/cgi-bin24/DM/y/ebF10Sn1nD0HjB0BFjT0Ec  (Neanderthal)
http://arstechnica.com/journals/science.ars/2006/5/16/3992  (Neanderthal DNA)
http://www.wired.com/wired/archive/14.07/caveman.html  (Neanderthal DNA)
http://www.isogg.org/neanderthaldna.htm  (Neanderthal mtDNA)

http://www.archaeology.org/0611/abstracts/neanderthals.html
http://www.newscientist.com/article/dn10275-neanderthal-dna-illuminates-split-with-humans.html (Neanderthal DNA)
http://www.nytimes.com/2007/10/02/science/02nean.html?_r=1&ref=science&oref=slogin (Neanderthal DNA)
http://www.sciencemag.org/cgi/content/abstract/1147417 (Neanderthal DNA suggests some had red hair and fair skin.)
http://abcnews.go.com/Technology/wireStory?id=689114   (400 year old Jamestown DNA sample)
http://www.nature.com/news/about/aboutus.html#Dalton   (10,000 year old American cave man DNA)
http://www.newscientist.com/article.ns?id=dn7988   (DNA from fossil bones.)
http://news.bbc.co.uk/1/hi/sci/tech/4260334.stm   (Extracting better quality DNA from ancient sources.)
http://www.everything2.com/index.pl?node_id=1476399 (mtDNA from Wales 24,000 years ago)
http://www.telegraph.co.uk/news/main.jhtml?xml=/news/2006/08/14/ndna14.xml (DNA from 1000 year old Pict bones)

http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12858290 (2000 year old Egyin Gol DNA)
http://www.abc.net.au/science/news/stories/s1722109.htm (Suggestions some human DNA comes from Neanderthals)
http://www.praguepost.com/articles/2007/04/25/dna-unmasks-czech-past.php (1000 year old Czech DNA)
http://www.msnbc.msn.com/id/21015458/ (Mammoth DNA- techniques for extracting DNA from ancient hair.)
http://www.foxnews.com/story/0,2933,298316,00.html  (very good Mammoth DNA from hair)
http://deposit.ddb.de/cgi-bin/dokserv?idn=982142943&dok_var=d1&dok_ext=pdf&filename=982142943.pdf  (3000 year old DNA from
the Lichtenstein Cave within the region of the Jastorf culture, in Lower Saxony)
http://www.genebaze.cz/cgi-bin/res/ydres_LCm.cgi?lang=us&n=cz (Lichtenstein Y-DNA results)
http://www.sciencedaily.com/releases/2008/04/080403141109.htm  (14,000 year old Native American DNA from Coprolites)
http://www.sciencedaily.com/releases/2008/05/080529141347.htm
http://dna-forums.org/index.php?showtopic=3991&hl=  (Cro-Magnon mtDNA 28,000 years old)
http://news.bbc.co.uk/2/hi/science/nature/8435317.stm  (30,000 year old mtDNA)
http://neandertal.ensemblgenomes.org/Homo_sapiens/Location/View?r=Y:15634687-15953405 Nenanderthal Y-DNA
http://neandertal.ensemblgenomes.org   (Neanderthal DNA)
http://www.spiegel.de/international/zeitgeist/0,1518,736454,00.html   New archaic human species

DNA databases:
http://www.ysearch.org/  (Y-Search Public database run by FTDNA)*****
www.openSNP.org
http://www.semargl.me/ru/dna/ydna/search/   Semargl ******
http://www.semargl.me/en/dna/ydna/search/  Semargl ******
http://freepages.genealogy.rootsweb.com/~geneticgenealogy/ysid2.htm (Y-Search-Search Utility, search be ID)*******
http://freepages.genealogy.rootsweb.com/~geneticgenealogy/ytex2.htm (Y-Search-Search Utility, search by haplotype)*******
http://freepages.genealogy.rootsweb.com/~geneticgenealogy/y.htm
(Y-Search-Search Utility, by Leo Little) *******
http://www.ybase.org/default.asp (Y-Base Public database) ***
http://www.ystr.org/      http://ystr.org  (20,000+ database, recently improved search features.)
www.yhrd.org     www.ystr.org  (Y-STR database)
http://freepages.genealogy.rootsweb.com/~geneticgenealogy/yhrd.htm  (Search utility for searching European locations on YHRD)
http://www.contexo.info/megaspreadsheet.htm   (Y-STR Allele frequencies)
http://www.ybase.org/statistics.asp   (Y-STR Allele frequencies)
http://ystr.charite.de/index_gr.html   (Haplotype reference database)
http://smgf.org/page.jspx?name=sorensondatabase   (SMGF database) ****
http://freepages.genealogy.rootsweb.com/~geneticgenealogy/SMGF/search4.htm  (Search engine for Sorenson database by Leo Little)
http://www.dna-fingerprint.com/modules.php?op=modload&name=ymatch   (Y-Match DNA Fingerprint database)
http://smgf.org:8081/pubgen/site28.jsp   (Sorensen Moelcular Genealogy Foundation- Database- also for an article
about Jim Sorenson, founder of the database see... http://www.sacbee.com/content/news/story/10454610p-11374060c.html )
http://new.relativegenetics.com   (Relative Genetics... new database, URL may change after testing)
http://www.oxfordancestors.com/members/yline/?msg=noresults   (Oxford Ancestors Database- may need to log on a guest.  From FTDNA calibration, "You'll need to convert your DYS389 numbers: subtract 3 from both DYS389-1 and DYS389-2, then subtract DYS389-1 from DYS389-2 to get DYS389ii-i  (Roman numeral two minus one). For example, if your results are 13-29, you would enter 10-16 at OA. You will also need a value for DYS425 -- 12 is a very strong modal in several haplogroups, although I don't know about J1. Not many companies measure DYS425.")

http://www.dna-fingerprint.com/user.php?op=register&module=NS-NewUser   (DNA Fingerprint database, new user)
http://www.sun-herald.com/NewsArchive2/061904/tp3np3.htm?date=061904&story=tp3np3.htm (Adopted child/parent DNA database)
www.identigene.com/SWIMX/Products/dff_main.asp (Adopted child/parent DNA database)
http://www.familytreedna.com/public/adoptees/  (Adoptees DNA Project)
http://www.donorsiblingregistry.com/  (Donor Sibling Registry)
http://www.africanancestry.com/databasemain.html   (African Ancestry Database)
http://www.mymcgee.com/tools/yutility.html   (Y-DNA comparison utility programme, not a database, but can be used in conjunction with databases).
http://www.appliedbiosystems.com/yfilerdatabase/   (Y Filer Database)
http://www.mymcgee.com/tools/yutility.html   (McGee DNA comparison utility)
*
http://www.dna-fingerprint.com/index.php?module=pagesetter&tid=1&filter=locus:like:385   (DNA fingerprint database)
http://www.ystrlog.org/  (Y-DNA)
http://marylb.free.fr/cgw30/fc30pa10.htm (Les patronymes étudiés)
http://www.cstl.nist.gov/biotech/strbase/NISTpop.htm
http://afrigeneas.com/forum/index.cgi?noframes;read=45572   (Reference to Howard University African American DNA Datrabase)
http://www.cstl.nist.gov/div831/strbase/str_yh4.htm   (NIST reference page)
http://www.ystr.org/index_gr.html   (Y database)

http://groups.yahoo.com/group/DNA-ANTHROGENEALOGY/database?method=reportRows&tbl=1   (SNP Database),
first go to http://groups.yahoo.com/group/DNA-ANTHROGENEALOGY/ and become member to access database
http://uk.geocities.com/hensoncymru/DNA/DYF399S1-R1bResults.JPG   (DYF399S1 database)
http://www.geocities.com/mcewanjc/s21.htm   (J McEwan's SNP Database)
http://www.journals.uchicago.edu/AJHG/journal/issues/v74n6/41028/datafile1.txt?erFrom=8617029170130421322Guest   (Kayser data on 8 samples from different haplogroups, with many markers tested... interesting, shows also different STR markers available.)****
http://www.journals.uchicago.edu/AJHG/journal/issues/v74n6/41028/41028.html (Kayser article relating to above... not a database)
http://www.scottishdna.net/  (Scottish Clans databases)
http://amadeus.biosci.arizona.edu/%7Ekcaldero/str.php (?)
http://www.appliedbiosystems.com/yfilerdatabase/  (Y-Filer Database)
http://www.genebaze.cz/cgi-bin/cyd.cgi?lang=us  (Czech Y-DNA Database)
http://www.jpac.pacom.mil/CIL/FRS_Home.htm  (Database of mtDNA of missing USA military persons.)
http://www.jpac.pacom.mil/FRS_public/FRS_public.aspx  (Search missing military persons surnames)
http://genome.cshlp.org/content/early/2009/08/20/gr.095000.109.abstract?papetoc  (Singapore genome database)

Full genome sequences:
http://www.worldpgr.com/ database of full genomes sequenced
http://huref.jcvi.org/  (Venter R1b)  
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi (Venter R1b)  http://jimwatsonsequence.cshl.edu/cgi-perl/gbrowse/jwsequence/   (Watson R1b)
http://yh.genomics.org.cn/mapview.jsp  (Han Chinese- haplogroup O?) 
http://yh.genomics.org.cn/   
http://www.dna-fingerprint.com/user.php?op=userinfo&uname=HUGO (Hugo reference sequence Mixed haplogroups, includes mostly R1b, some G, some I)
ftp://ftp.ncbi.nih.gov/pub/TraceDB/ShortRead/SRA000271/    (in the directory fastq the sequence for the Yoruba NA18507 is available.)
Craig Venter:
http://www.ncbi.nlm.nih.gov/sites/entrez?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=19621
James Watson:
http://www.ncbi.nlm.nih.gov/sites/entrez?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=28335
Yoruba NA18507:
http://www.ncbi.nlm.nih.gov/sites/entrez?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=29429
http://genome.cshlp.org/content/early/2009/05/26/gr.092197.109  (Korean full sequence)
ftp://ftp.kobic.kr/pub/KOBIC-KoreanGenome/ (Korean full sequence data)
http://www.personalgenomes.org/public/6.html (Pinker full sequence)
http://www.snpedia.com/index.php/PGP10  (Personal Genome Project Participants)
http://www.smartplanet.com/technology/blog/science-scope/the-amazing-race-for-the-cheapest-and-fastest-dna-machine/220/

DNA-Mailing Lists/ DNA Forums/ Blogs etc:

(some useful pointers on posting messages on mailing lists
The news.newusers.questions FAQ
http://www.plig.net/nnq/nquote.html
How to post to uk news groups http://www.usenet.org.uk/ukpost.html
Proper quoting style explained http://www.uwasa.fi/~ts/http/quote.html )
http://www.isogg.org/wiki/Genetic_genealogy_mailing_lists  (ISOGG list of forums and lists)*******
http://lists.rootsweb.com/index/other/DNA/GENEALOGY-DNA.html   (join list/ search archives etc)
http://lists.rootsweb.com/index/other/Miscellaneous/GENEALOGY-DNA.html (DNA Forum archives)
Search the GENEALOGY-DNA archives
Browse the GENEALOGY-DNA archives
http://lists.rootsweb.com/index/other/DNA/ ***
http://www.dna-forums.org/
 (DNA Forum)
DNA-NEWBIE-subscribe@yahoogroups.com   ("Newbie" DNA discussion list)
http://members.aol.com/dnacousins/Welcome.txt   (DNA list welcome message)
http://www.isogg.org/  (International Society Of Genetic Genealogists- membership is free)***
http://www.ybase.org/forum/forum_topics.asp?FID=518   (Marsh DNA Forum run by DNA Hertiage)
http://members.aol.com/dnacousins/Welcome.txt   (Welcome message to DNA list, gives FAQ about DNA, good intro)**
http://listsearches.rootsweb.com/cgi-bin/listsearch.pl   (enter "Genealogy-DNA" to search DNA list)
http://www.familytreeDNA.com/facts_genes.asp?act=past   (FTDNA monthly DNA magazine- back issues)
http://www.familytreeDNA.com/fgregister.asp   (to subscribe to FTDNA Facts and Genes- DNA monthly magazine)
http://genforum.genealogy.com/dna/   (DNA forum)
http://j.webring.com/hub?ring=dnasurnameprojec&list&page=0   (DNA web ring)
http://www.familytreedna.com/forum/<http://www.familytreedna.com/forum/   (FTDNA Forum.)
http://ttatw.com/mailman/listinfo/truth_ttatw.com   (List to discuss religious or Biblical correlations with DNA-genealogy)
SCOT-DNA-L@rootsweb.com (Scots DNA Mailing list)
http://www.familytreedna.com/forum/forumdisplay.php?s=&forumid=64 (R1b Forum)
http://www.afrigeneas.com/forum-dna/  (African American DNA Research Forum)
http://vandermerwede.org/forums/index.php  (van der Merwede Forum)
http://groups.yahoo.com/group/dna-anthrogenealogy/  (Anthrogenealogy)
http://spittoon.23andme.com/ (Blogs including information about "23andme")
http://dnaancestry.typepad.com/blog/  (DNA Ancestry blog)
http://rjgg.molgen.org/index.php/RJGGRE  (Russian journal of genetic genealogy)
http://genforum.genealogy.com/dna/
http://www.worldfamilies.net/forum/
http://www.eupedia.com/forum/forumdisplay.php?f=202
http://www.eupedia.com/forum/showthread.php?p=352310

DNA sample storage systems:
(For those wanting to store DNA from family members for future testing.   As DNA technology improves, it is likely that many more sophisticated tests will be available in the future.  Several manufacturers offer test kits which are believed would store DNA for 30 years.)
http://www.genetic-identity.com/DNA%20Archving/dnabanking.html
http://www.dnafiler.com/
www.dnagenotek.com.  They are a Canadian company that makes the Oragene saliva collection kit which, when capped, releases purifying chemicals and allows storage at room temperature for many years. 

Video/ Audio on DNA projects/ subjects:
http://www.FamilyTreeDNA.com/videoaudio.html   (Genealogy by genetics video)
http://www.itconversations.com/shows/detail255.html   (Spencer Wells audio lecture on DNA, 51 minutes)
http://www.testsite.co.za/  (National Geographic DNA Project Conference May 2006, Video)
http://www.rootstelevision.com/players/player_dna.php?bctid=316039826 (Various DNA Videos)
http://www.rootstelevision.com/players/player_dna.php?bctid=1351299777
http://www.isogg.org/dnastories.htm
http://www.bradshawfoundation.com/journey/  (Journey of Mankind)
http://www.rootstelevision.com/

Genetic books & articles on line/ on line DNA libraries etc:
http://www.ncbi.nlm.nih.gov/books/bv.fcgi?call=bv.View..ShowTOC&rid=mga.TOC&depth=10   (Genetic book)
http://www.familytreedna.com/library.html   (Library of Scientific papers on DNA)
http://www.leicester.ac.uk/genetics/maj4/SurnamesForWeb.pdf   (Surnames and genetics)
http://www.le.ac.uk/genetics/maj4/JoblingTS.03.NRG.Review.pdf   (Good technical article of Y chromosome)
http://vetinarilord.blogspot.com
www.historicalgeneitcs.com
http://www.jogg.info  (Genetic Genealogy Journal- free- on line)
www.familytreedna.com (DNA reference articles on line....click on "Library" and then "Y-DNA")
http://www.familytreeDNA.com/library.html  (FTDNA library of research articles)
http://www.nih.gov/news/health/oct2009/nhgri-20.htm  (Genetic terms)


Genetic books not available on line:
http://www.kerchner.com/books/dnabooks.htm  (DNA Books)
http://www.amazon.co.uk/exec/obidos/ASIN/1841196975/geogene-21/202-1068448-3891867   (Out of Eden: The Peopling of the World- Openheimer)
http://www.amazon.co.uk/exec/obidos/ASIN/0141008326/geogene-21/202-1068448-3891867   (The Journey of Man: A Genetic Oddesy- Spencer Wells)
http://www.amazon.com/exec/obidos/ASIN/1550025368/   (Trace your roots with DNA- Chris Pomery)
http://honoringourancestors.com/books.html   ("Trace Your Roots with DNA" by Smolenyak and Turner)***
http://fairuse.100webcustomers.com/fuj/salon10.htm  (Review of "Before the Dawn" a book on DNA genealogy by Nicholas Wade)
http://www.rootstelevision.com/players/player_dna.html (DNA- genealogy stories etc)
http://astore.amazon.com/genpagecom-20/
www.bloodoftheisles.net
http://www.abrahamschildren.net
http://www.genealogymagazine.com/entine.html
http://www.thegeneticgenealogist.com/wp-content/uploads/InterpretingTheResultsofGeneticGenealogyTests.PDF (free booklet on genetic genealogy)
http://hpgl.stanford.edu/publications.html (Stanford genetics publications free on line)

Genetics course:
http://www.edoutreach.washington.edu/openuw/asp/transform.asp?course=Genetics&xml=genetics_intro1 (free on line course)

DNA & Privacy Laws etc:
http://cerbere.ca/genetique/empreintes-génétiques.htm  (French law on genetic testing)
http://www.opsi.gov.uk/acts/acts2004/40030--d.htm#45  (Non-consensual analysis of DNA is at section 45)
http://www.ornl.gov/sci/techresources/Human_Genome/elsi/legislat.shtml (USA genetics legislation)
http://www.copyright.gov/circs/circ65.html#definition (Issues re copyright)
http://www.copyright.gov/circs/circ66.html#databases  (Issues re copyright)
http://www.copyright.gov/help/faq/faq-protect.html#website  (Issues re copyright)
http://admi.net/code/CSANPUNL-L1131-1.html  (Some French laws)
http://www.aslme.org/dna_04/work3/report.php
http://www.cancerdiagnosis.nci.nih.gov/specimens/50_state_survey/caseStudies3.htm
http://biology.plosjournals.org/perlserv/?request=get-document&doi=10.1371/journal.pbio.0060073&ct=1 (Research Ethics Recommendations)
http://www.eurogentest.org/uploads/1247230263295/GenDG_German_English.pdf

Mitochondrial DNA:
(Mitochondrial DNA, which descends down the direct female line of ancestors, is unrelated to Y-DNA used for the Marsh Surname Project.  However, some participants may obtain Mitochondrial DNA tests as part of additional tests offered by the test company.   Mitochondrial DNA is not the focus with this project, but some limited references will be included here for those who wish to widen there interest to mtDNA.)
http://worldfamilies.net/mtDNA.htm   (General info)
http://www.argusbio.com/tools_docs/world_tree7.3.pdf  (mtDNA Tree)
*****
http://www.phylotree.org/ 
(mtDNA Tree) ******
http://www.mitomap.org/
http://vps1.jameslick.com/dna/mthap/
http://www.geneticorigins.org/geneticorigins/mito/mitoframeset.htm
http://www.mitomap.org/mitoseq.html
(Revised Cambridge Reference Sequence)
https://www2.carolina.com/webapp/wcs/stores/servlet/ProductDisplay?jdeAddressId=&catalogId=10101&storeId=10151&productId=18909&langId=-1&parent_category_rn=&crumbs=n 
(mtDNA testing for school projects)
 http://www.isogg.org/ancientdna.htm 
(Ancient mtDNA)
http://www.jogg.info/32/logan.htm (estimated mtDNA of Eve)
http://www.argusbio.com/sooryakiran/gensnip/gensnip.php (Programme to analyze mtDNA)
http://ghr.nlm.nih.gov/ghr/template/gen,chromosome,MT.vm  (Genetics home reference page)
www.ilbg18230.pwp.blueyonder.co.uk/programs/analyser.htm (mtDNA mutation lists)
http://www.familytreednacom/mtDNA_tutorial.html>  (mtDNA tutorial)http://www.isogg.org/famousdna.htm   (mtDNA of famous people)
http://www.isogg.org/neanderthaldna.htm (Neanderthal mtDNA)
http://scs.uiuc.edu/~mcdonald/worldmtdnamap.pdf   (World map with mtDNA haplotypes distribution)
http://www.bioanth.cam.ac.uk/mtDNA/   (Mitochondrial DNA Concordance)
http://www.mitosearch.org/    (FTDNA Mitochondrial Database)
http://www.genpat.uu.se/mtDB/index.html   (mtDNA Database)
http://www.genpat.uu.se/mtDB/  (mtDNA database where you can query one base at a time)
http://www.fbi.gov/hq/lab/fsc/backissu/april2002/miller1.htm#Accessing%20the%20mtDNA%20Population%20Database  (mtDNA Database)
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?CMD=search&DB=nuccore  (Some full mtDNA sequences- type "family Tree DNA" into search box)
http://home.earthlink.net/~wilsondna/FILE_DOWNLOAD_PAGE.htm   (mtDNA Database- based on mitosearch)
http://www.nature.com/nature/journal/v404/n6777/fig_tab/404490a0_F2.html   (Neandethal mitochondrial DNA- see also DNA forum posting 2 Dec 2004)
http://freepages.genealogy.rootsweb.com/~ncscotts/mtDNA/Neanderthal%20mtDNA.pdf  (Neanderthal mtDNA sequences)
http://freepages.genealogy.rootsweb.com/~jswdna/jchart.gif  (J Haplogroup)
http://tech.groups.yahoo.com/group/J-mtDNA/  (J Haplogroup)
http://www.familytreedna.com/(iwlk1yuk04p51t2firjs1445)/public/J1b1/index.aspx  (J Haplogroup DNA Project)
http://worldfamilies.net/mtdna/jstar/index.html  (J* haplogroup project)
http://tech.groups.yahoo.com/group/J-mtDNA/  (J haplogroup discussion group)
http://www.familytreeDNA.com/hclade.html   (mtDNA Haplogroup H)
http://freepages.genealogy.rootsweb.com/~wrhurst/mtdna-k/k500post.htm (Haplogroup K survey)
www.gen.tcd.ie/molpopgen/data.html   (Irish mtDNA database)
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&list_uids=16151183&query_hl=1   (Brittish mtDNA)
http://www.mcdonald.cam.ac.uk/genetics/labpubs.html#anchor1565740 (Includes showing mtDNA haplotypes spreading out of Africa)
http://www.tracegenetics.com/services_research_library.html (Library of mtDNA studies)
http://news.yahoo.com/news?tmpl=story&u=/afp/20040527/sc_afp/sweden_science_health_genetics_aging_040527140653   (mtDNA & the aging process)
http://www.newscientist.com/hottopics/dna/article.jsp?id=23974800&sub=Ancestry   (Viking mtDNA)
http://www.mtdnalog.org/  (mtDNA test log)
http://www.guardian.co.uk/italy/story/0,12576,1256459,00.html   (Medici family)
http://bioweb.usc.edu/documents/bisc406-lab_luke.pdf   (DNA of the body attributed to the Evangelist Luke?)
#  Marie Antoinette is haplogroup H, HVR1 T16519C, HVR2 T152C, C194T, A263G and N315.1C
http://www.pnas.org/cgi/content/full/98/2/537   (Ancient mtDNA Australia)
http://www.brookingsociety.org.uk/mtdna.htm   (mtDNA analysis programme)
http://www.genetests.org/query?dz=mt-overview  (Mitochondrial disorders)
http://www.ftdna.com/facts_genes.asp?act=show&nk=3.2   (mtDNA mutation rates)
http://archiver.rootsweb.com/th/read/GENEALOGY-DNA/2004-03/1079482461   ("Famous" mtDNA haplotypes)
http://www.bionet.nsc.ru/bgrs/thesis/99/   (mtDNA from Pazaryk Caucasian mummies of 2,500 years ago in China)
http://www.tymri.ut.ee/PhD/2004/tambets_thesis.pdf (Thesis- "THE UNDERSTANDING OF POST GLACIAL SPREAD OF HUMAN MITOCHONDRIAL DNA HAPLOGROUPS IN EUROPE AND BEYOND: A PHYLOGENETIC APPROACH")
http://www.ilbg18230.pwp.blueyonder.co.uk/mtdna.htm
http://freepages.genealogy.rootsweb.com/~wgeorge/dna/mtdna_cornwall.html   (Cornish mtDNA)
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=61743586 (NCBI nucleotide site mtDNA Complete Sequences)
http://www.genpat.uu.se/mtDB/   (University of Uppsala, a search engine to look for particular mutations)
www.brookingsociety.org.uk/mtdna.htm (phylogenetic trees for most of the sequences)
http://www.geneticancestor.com/  (mtDNA in Europe, research project)
http://www.bloodoftheisles.net/OGAP_mDNA.pdf  (Sykes mtDNA sequences)
http://www.genpat.uu.se/mtDB/  (2000+ mtDNA sequences)
http://freepages.genealogy.rootsweb.com/~ncscotts/mtDNA/mtDNA%20HVR1%20Mutation%20Distribution.htm  (8,000+ mtDNA sequences)
http://www.ianlogan.co.uk/  (mtDNA- interesting site)
http://www.ianlogan.co.uk/haplogroup/instructs.htm (List of full mtDNA sequences)
http://genetics.plosjournals.org/perlserv/?request=get-document&doi=10.1371/journal.pgen.0030104#toclink3 (Nat Geo mtDNA Database)
http://www.genebase.com/blog/  (Blogs on mtDNA)
https://www3.nationalgeographic.com/genographic/resources.html
http://www.mitomap.org/cgi-bin/tbl6gen.pl (mtDNA mutations- list)
http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0008260 (dating by mtDNA mutations)
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2788364/?itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_SingleItemSupl.Pubmed_DiscoveryDbLinks&ordinalpos=1&tool=pubmed



X-Chromosome  DNA:

http://davidkfaux.org/X_CHROMOSOME_Haploblock_Resources.pdf  (X-Chromosome resources)
http://davidkfaux.org/X_Facts.pdf


7) MUTATION RATES FOR INDIVIDUAL Y-DNA MARKERS

http://www.nature.com/ejhg/journal/v19/n1/full/ejhg2010154a.html  (Detailed mutation rate study 110 markers)
http://www.worldfamilies.net/marker.htm (collection of STR mutation rate estimates)
http://www.jogg.info/22/Chandler.htm  (John Chandler mutation rate estimates)
http://freepages.genealogy.rootsweb.ancestry.com/~geneticgenealogy/ratestuff.htm (mutation rates)
http://download.cell.com/AJHG/mmcs/journals/0002-9297/PIIS0002929710004192.mmc1.pdf <<<<<IMPORTANT ARTICLE
http://freepages.genealogy.rootsweb.ancestry.com/~geneticgenealogy/yfreq.htm  (Allele frequencies)


Mutation rates as on DNA List Posting 13 Apr 2011: 

      DYS 589:  .0006248
      DYS 607:  .003733
      DYS 636:  .002309
>
>
> -----Original Message-----
> From: Tim Janzen
>> DYS632:  .000397
>> DYS540:  .003300
>> DYS525:  .00978
>> DYS712:  not given
>> DYS593:  .00151
>> DYS650:  not given
>> DYS532:  .00324
>> DYS715:  not given
>> DYS504:  .003240
>> DYS513:  .006090
>> DYS561:  .000941
>> DYS552:  .002690
>> DYS587:  .002620
>> DYS497:  .001490
>> DYS510:  .005990
>


Mutation rates as on DNA List Posting 16 June 2008: 

I don't recall that anyone on the list has ever tried to define the breakpoints between slow, medium, and fast mutating markers before. As others have mentioned, this is an arbitrary decision. I sorted the 67 markers in the FTDNA 67 marker panel as well as 9 markers included in the SMGF 43 marker panel that aren't included in the FTDNA 67 marker panel by their mutation rates as found on Leo Little's web site at http://freepages.genealogy.rootsweb.ancestry.com/~geneticgenealogy/ratestuff

.htm. The mutation rates were calculated by John Chandler. These rates are probably among the most accurate mutation rates that have been published to date. I arbitrarily chose a mutation rate of 0.001 as the breakpoint between slow and medium mutating markers. I arbitrarily chose a mutation rate of 0.005 as the breakpoint between medium and fast mutating markers. I hope you find this list of help to you. Feel free to chose different breakpoints if you prefer.

Sincerely,

Tim Janzen

Marker Type Rate Testing Company

472 slow 0.00001 FTDNA

578 slow 0.00008 FTDNA

426 slow 0.00009 FTDNA, SMGF

454 slow 0.00016 FTDNA, SMGF

455 slow 0.00016 FTDNA, SMGF

425 slow 0.00018 FTDNA

436 slow 0.00018 FTDNA

641 slow 0.00018 FTDNA

490 slow 0.00019 FTDNA

450 slow 0.0002 FTDNA

388 slow 0.00022 FTDNA, SMGF

594 slow 0.00029 FTDNA

395s1 slow 0.00031 FTDNA

395s1 slow 0.00031 FTDNA

640 slow 0.00034 FTDNA

531 slow 0.00037 FTDNA

492 slow 0.00042 FTDNA

617 slow 0.00042 FTDNA

392 slow 0.00052 FTDNA, SMGF

568 slow 0.00053 FTDNA

462 slow 0.00053 SMGF

590 slow 0.00054 FTDNA

438 slow 0.00055 FTDNA, SMGF

537 slow 0.00057 FTDNA

393 slow 0.00076 FTDNA, SMGF

565 slow 0.00087 FTDNA

B07 slow 0.00093 SMGF

487 slow 0.00097 FTDNA

437 slow 0.00099 FTDNA, SMGF

YCAIIa medium 0.00123 FTDNA, SMGF

YCAIIb medium 0.00123 FTDNA, SMGF

511 medium 0.00128 FTDNA

459a medium 0.00132 FTDNA, SMGF

459b medium 0.00132 FTDNA, SMGF

441 medium 0.00132 SMGF

448 medium 0.00135 FTDNA, SMGF

19 medium 0.00151 FTDNA, SMGF

406s1 medium 0.00154 FTDNA

463 medium 0.00162 SMGF

389i medium 0.00186 FTDNA, SMGF

413a medium 0.00202 FTDNA

413b medium 0.00202 FTDNA

H4 medium 0.00208 FTDNA, SMGF

572 medium 0.00212 FTDNA

385a medium 0.00226 FTDNA, SMGF

385b medium 0.00226 FTDNA, SMGF

461 medium 0.00233 SMGF

C4 medium 0.00236 SMGF

389ii medium 0.00242 FTDNA, SMGF

520 medium 0.00245 FTDNA

447 medium 0.00264 FTDNA, SMGF

391 medium 0.00265 FTDNA, SMGF

445 medium 0.00296 SMGF

390 medium 0.00311 FTDNA, SMGF

452 medium 0.00314 SMGF

557 medium 0.00321 FTDNA

444 medium 0.00321 FTDNA, SMGF

442 medium 0.00324 FTDNA, SMGF

446 medium 0.00365 FTDNA, SMGF

A10 medium 0.00379 SMGF

460 medium 0.00402 FTDNA, SMGF

607 medium 0.00411 FTDNA

439 medium 0.00477 FTDNA, SMGF

481 fast 0.00544 FTDNA

464a fast 0.00566 FTDNA, SMGF

464b fast 0.00566 FTDNA, SMGF

464c fast 0.00566 FTDNA, SMGF

464d fast 0.00566 FTDNA, SMGF

456 fast 0.00735 FTDNA, SMGF

570 fast 0.0079 FTDNA

458 fast 0.00814 FTDNA, SMGF

534 fast 0.00832 FTDNA

449 fast 0.00838 FTDNA, SMGF

576 fast 0.01022 FTDNA

CDYa fast 0.03531 FTDNA

CDYb fast 0.03531 FTDNA



Mutation rates is a technical issue which participants in the Marsh DNA Project don't really need to know about:  I don't intend to leave this section on mutation rates permanently here.  It is only here until I get well enough organized to put it somewhere else  (ie it might end up being here permanently).  The importance of mutation rates, is that to get a feel for how long ago two people may have had a common ancestor, you need to know what mutation rates are, to apply statistical formulas.  Because DNA science is relatively new, and mutations are relatively rare, there is still not enough statistical data for experts to agree on mutation rates.  Some studies say average mutation rates are 0.0015, and other studies say it may be 0.0042.  By some accounts, the mutation rate of 0.0029 is the for the average for the first 25 FTDNA markers.  However, some claim the FTDNA figures are too high, and the rate is closer to 0.002.  (The average will vary depending on which set of markers you are considering, eg, 12, 25, 37 etc.  The first 12 markers of FTDNA tend to be slower mutating than the other markers.)  An important research study by FTDNA on mutation rates is due to be published in the first half of 2004.

On the Genealogy-DNA list  (Doug MacDonald, 29 Feb 2004, and 2? Mar 2004), one contributor produced his estimates of individual marker mutation rates based on the Sorensen Molecular Genealogy database.  He stresses these are only his analysis, but the results look interesting   (Following copied from the DNA List)...

Here is a second look at the Sorenson rates. None have
changed from my first list by
a significant amount. The slowest ones dropped a bit,
and in fact they may actually be
as low as .0004. They are hard to back-calculate.

Again, this is Sorenson's data, not mine. I merely
reverse engineer assuming Walsh's infinite alleles
model. I have done several different methods of
checking and all agree.
The error bars are of course known only to Sorenson.
Hopefully they will publish soon.


Marker Rates
385    .0033 (*)
388    .0005
389I   .0021
389II  .0028
390    .0045
391    .0036
392    .0016
393    .0012
19      .0016
426    .0005
437    .0020
438    .0012
439    .0045
447    .0045
448    .0028
449    .0075
454    .0005
455    .0005
458    .0066
459    .0014 (*)
460    .0028
461    .0028
462    .0005
ggaat1b07      .0013
ycaii                .0014   (*)
ygataa10         .0045
ygatac4           .0028
ygatah4           .0036


Note: the values marked by a (*) have been divided by
two from what Sorenson uses.
This is because they are double markers. What Sorenson
is doing is counting the pair as one marker. If either
changes they count this as one mutation. If you do
this, you need to double the rate I show here. If you
count the marker twice, as two markers, the best you
can do is use the rates I show here, which are half
what Sorenson uses. They could, of course, actually be
two different rates which average the value I give in
this list. The two 389 values are listed separately
and does not suffer this ambiguity.

The average for the FTDNA 12 set is .0025. You cannot
calculate it for the other FTDNA sets because this set
lacks 464. Assuming 464 is fast, it would be about
.0028 to .0030.
You can calculate the averages yourself for other sets
(except of course ones that Sorenson does not use.)

There is a factor of (about) 15 in rate from the
slowest to the fastest. Why?

Following is an alternative estimate by Doug MacDonald on the DNA Forum 28 Nov 2004, based on different sources.

393 0.0014
390 0.006
19 0.0025
391 0.0059
385a 0.005
385b 0.005
426 0.0007
388 0.0018
439 0.008
389-1 0.0035
392 0.002
389-2 0.0052
458 0.0095
459a 0.0025
459b 0.0025
455 0.0007
454 0.0007
447 0.0075
437 0.0027
448 0.004
449 0.015
464a 0.0063
464b 0.0063
464c 0.0063
464d 0.0063
460 0.0065
gatah4 0.0075
ycaiia 0.004
ycaiib 0.004
456 0.01
607 0.0095
576 0.015
570 0.014
cdya 0.017
cdyb 0.017
442 0.006
438 0.002

Mutation rate study by Charles Kerchner- as at March 2008:

All:

Since my last update I have received some more 37 and 67 marker haplotype data entries.

Here are the latest average YSTR mutation rates for the various YSTR panel sizes which have been entered by Surname Project Admins into my "Y-STR Haplotype Observed Mutation Rate Log" and YSTR mutation rate study. These rates are for the four FamilyTreeDNA marker panels, including the newest 30 marker 30(38-67) upgrade panel to 67 markers. I also show the composite YDNA37 37 marker and

YDNA67 67 marker haplotype rates. These averages are computed from thousands of marker mutation opportunities (MMOs). See the project for more details on that.

More 67 marker haplotype project entries and updates to prior entries are encouraged. If you already have an older entry you made years or months ago into my YSTR Mutation Rate Log for your project, consider updating it with any newer data you have accumulated, including the newer 67 marker testing. The data below is from 50 surname projects tested to 37 markers or 67 markers as of the 13 Mar

2008 data date.

YSTR Panels and Haplotypes

Observed Weighted Average Mutation Rates and MMOs

-------------------------------------------------

12(1-12) panel 0.0025 +- 0.0003 (26,568)

13(13-25) panel 0.0031 +- 0.0003 (28,301)

12(26-37) panel 0.0071 +- 0.0005 (25,164)

30(38-67) panel 0.0017 +- 0.0004 ( 8,640)

12(1-12) haplo 0.0025 +- 0.0003 (26,568)

25(1-25) haplo 0.0028 +- 0.0002 (54,425)

37(1-37) haplo 0.0042 +- 0.0002 (81,992)

67(1-67) haplo 0.0031 +- 0.0004 (19,296)

For more details about these panel's average mutation rates and other panels and haplotype sizes mutation rates, see the summary PDF data table file link in the YSTR Mutation Rate Log website. These rates are possibly useful to other scientists or hobby scientists as calibration/reference points for other methodologies in studying average YSTR mutation rates and/or individual marker mutation rates. I am collecting the data to further knowledge in this new field and to be helpful to all. I ask for your cooperation and understanding and help with gathering more participants and thus data:

http://www.ystrlog.org/

Also, take a look at the 37 marker histogram page which shows some interesting observed differences if average mutation rates observed from one haplogroup to another. Particularly take a look at the difference between R1b, I1a, and R1a histograms. Limited data yes, but some interesting early signals, imo.

http://www.kerchner.com/ystrlog/ystr1to37histogram.htm

As the robot in short circuit said ... "more data". I need more data. Project Admins are encouraged to submit more entries for "known to be related" tested males who share a known Most Recent Common Ancestor (MRCA) for a related group or cluster in your surname project. Your shared data contributes to the knowledge base for this new field. See the project website for more details about the project, who can join, and how to submit data. It is not all that hard to do and of course I am willing to help you. But you need to know the traditional paper trail genealogy from the MRCA for the group/cluster being submitted. The add entry form has now been automated to do all the arithmetic calculations of the mutation rates.

My project also has been documenting some very old family tree pedigrees proven by both traditional genealogy research and YDNA testing. See the project website for more details on that. See my long standing challenge at the top of the log page. Do you have an old proven pedigree to share, proven by both paper trail and YDNA testing? If so, please consider submitting it to my log.

http://www.ystrlog.org/

My project is now over three years old. I need more data. Please spread the word about this project and encourage people who have relevant data to join. Sharing your data is helpful to all.

Synergy at Work!

Charles Kerchner

(P.E. Retired)

Emmaus PA USA

Project Admin

Kerchner's YSTR Mutation Rate Log and Study:

http://www.ystrlog.org/

http://www.kerchner.com/dna-info.htm

NEW DNA MUTATION RATE STUDY RELEASED NOV 2004:

FTDNA released results of a study Nov 2004.  The way data was collected, it has been questioned by some if it may have biased results.  However, in the absence of good information, it is a significant study.  This indicates the mutation rate is faster than originally thought. The average mutation rate of the markers used by FTDNA is as follows....

Markers 1-12 = 0.0040
Markers 13-25 = 0.0048
Markers 26-37 = 0.0075
Markers 1-25 = 0.0044
Markers 1-37 = 0.0054

(Doug MacDonald said some indications from other sources are 1-12 = 0.0022, 1-25 = 0.0027, 1-37 = 0.0036)

In simple terms, this means that on average, you might expect one mutation every 21 generations with 12 markers, every 9 generations with 25 markers, and every 5 generations with 37 markers. 

However, there are a number of factors at play which need to be allowed for.  Some markers, if they have very high or low scores might be more likely to mutate, meaning that some families might be prone to more mutations than other families.  It might also be significant to take into consideration if it is slow or fast mutating markers which have mutated.  Other markers seem to mutate in more than one step at a time, and this needs to be considered.

MUTATION RATE STUDIES- FATHER SON PAIRS:

http://archiver.rootsweb.com/th/read/GENEALOGY-DNA/2005-04/1113356244  
http://www.springerlink.com/content/e851161060443056/
http://www.springerlink.com/content/47570430mm5m106v/
http://www.yhrd.org/Research/Loci
http://www.nature.com/ejhg/journal/v19/n1/extref/ejhg2010154x3.pdf


POSTED ON DNA FORUM 8 MAY 2006:
Mutation rates of new FTDNA Markers

most of the new markers were in the supplementary data to the Kayser paper.

A quick look at the data suggests the following

DYS472 8 or 9, slow.
DYS511 10 or 11, slow.
DYS531 11-13, slow to medium
DYS537 10 or 11, slow
DYS594 8-11, slow
DYS578 7-10, slow
DYS590 8-9, slow
DYS641 7-10, slow
DYF395S1/2 13-14, medium (but with possible recombination mutations)
DYF406S1 10-14, medium
DYS436 8-12, slow
DYS444 9-17, medium/fast (see SGMF stats)
DYS446 8-23, medium/fast (see SGMF stats and Whit's recent paper).
DYS481 22-27, fast (very?)
DYS490 12-14, slow/medium
DYS520 18-24, fast? (appears to contain 2 variable repeat sections)
DYS534 14-16, medium
DYS557 14-23, medium/fast
DYS492 11-13, slow
DYS565 10-12, slow
DYS572 10-11, slow

ISOGG Article: 

Mutation rate Article in ISOGG by John Chandler http://www.jogg.info/22/Chandler.htm

8) COMPARISONS OF MARKER NAMES BEWTEEN LABS:

Some DNA labs have slightly different marker names, and calibrations.  To compare markers between labs, some adjusments need to be made.  As at 3 March 2004, following is comparative list, but this is likely to soon be changed, as labs reach agreement on standard systems.  (Another description on camparing results from different labs can be found at http://www.kerchner.com/labmerge.htm)   See also http://smgf.org:8081/pubgen/site40.jsp ***.

Although not shown below, I beleive GATTA H4 has some variation between the labs.   For example, there is a difference of 1 between FTDNA and Sorenson. 

Locus DYS#
FTDNA/ REL GEN/ HERITAGE/ SORENSEN
1 393 1 393 1 393 1 393
2 390 2 390 2 390 2 390
3 19*/394 3 394 3 394 3 394
+1 (FT RG)
4 391 4 391 4 391 4 391
5 385a 5 385a 5 385a 5 385a
6 385b 6 385b 6 385b 6 385b
7 426 7 426 7 426 7 426
8 388 8 388 8 388 8 388
9 439 (A4) 9 439 9 439 9 439
10 389-1 10 389-1 10 389-1 10 389-1
11 392 11 392 11 392 11 392
12 389-2 12 389-2 12 389-2 12 389-2
13 458 13 458
14 459a 14 459a
15 459b 15 459b
16 455 13 455 16 455
17 454 14 454 17 454
18 447 15 447 18 447
19 437 16 437 13 437 19 437
20 448 20 448
+3 (FT RG)

21 449 21 449
22 464a -
23 464b -
24 464c -
25 464d -
26 460 17 460 14 460 22 460
27 GATA H4 18 H4 15 H4 23 H4
28 YCA II a 19 YCAIIa 24 YCA11a
29 YCA II b 20 YCAIIb 25 YCA11b
30 456 -
31 607 -
32 576 -
33 570 -
34 CDY a -
35 CDY b -
36 442 -
37 438 21 438 16 438 26 438
22 461 17 461 27 461
23 462 18 462 28 462
24 BO7 29 B07
25 A10 19 A10 30 A10
26 C4 20 C4 31 C4
21 425 -

Nomenclature changes June 2004:

http://www.ybase.org/convert.asp

DNA Forum posting 29 Sept 2005 by John Chandler....

Time for another update on mutation rates.  I downloaded 2122
37-marker haplotypes from Ysearch, representing a mix of haplogroups,
and used the method described in the SMGF poster ASHG 2004-4, entitled
"Direct determination of mutation characteristics of Y chromosome STR
loci," to determine the mutation rates.  However, I used the recently
augmented YHRD table of direct mutation-rate measurements from
father-son pairs as the calibration.  I also converted the reported
SMGF rates to the same new calibration scale for comparison.  Finally,
I computed the average rates for a variety of panels and tossed in the
corresponding panel averages announced by FTDNA at last year's
conference and the ones calculated from Charles Kerchner's log as of
now.  Note: the multi-copy markers are shown here with the rate for
each copy assuming equipartition, and the panel averages are computed
by counting each copy as a separate marker.

Note the peculiarity of the log data: the average for 1-25 is higher
than either 1-12 or 13-25.  This suggests a bias in the decisions to
upgrade from 12 to 25 -- those with observed mutations in a 12-marker
test were significantly more likely to upgrade than those with a 12/12
match.  In particular, the average rate for the 12-marker tests of
those who upgraded is 0.00267, while the average for those who did
not upgrade is 0.00175.  This effect would be even stronger if we
could count the 11/12 near-matches that exploded upon upgrade and
were therefore eliminated from the statistics.

John Chandler

----------------------------------------------------------------------
(This table is formatted to line up more-or-less correctly with both
proportional and fixed fonts.)

Locus ____ --SMGF_ASHG_2004-4--- ____ YSEARCH ____ FTDNA ____ K_Log
_____ ____ (poster) ____ (scale) ____ (scale)  
385ab ____ 0.002800 ____ 0.00230 ____ 0.00217
388 ______ 0.000379 ____ 0.00031 ____ 0.00040
389i _____ 0.002184 ____ 0.00179 ____ 0.00179
389ii-i __ 0.002584 ____ 0.00212 ____ 0.00219
390 ______ 0.004405 ____ 0.00361 ____ 0.00370
391 ______ 0.003155 ____ 0.00259 ____ 0.00255
392 ______ 0.001488 ____ 0.00122 ____ 0.00136
393 ______ 0.001119 ____ 0.00092 ____ 0.00090
394 ______ 0.001548 ____ 0.00127 ____ 0.00123
426 ______ 0.000271 ____ 0.00022 ____ 0.00024
437 ______ 0.001755 ____ 0.00144 ____ 0.00144
438 ______ 0.001018 ____ 0.00084 ____ 0.00077
439 ______ 0.004181 ____ 0.00343 ____ 0.00349
441 ______ 0.001323 ____ 0.00109 ____ -------
442 ______ 0.003066 ____ 0.00252 ____ 0.00232
444 ______ 0.002956 ____ 0.00243 ____ -------
445 ______ 0.000952 ____ 0.00078 ____ -------
446 ______ 0.003143 ____ 0.00258 ____ -------
447 ______ 0.003891 ____ 0.00319 ____ 0.00308
448 ______ 0.002375 ____ 0.00195 ____ 0.00202
449 ______ 0.006464 ____ 0.00531 ____ 0.00574
452 ______ 0.001743 ____ 0.00143 ____ -------
454 ______ 0.000235 ____ 0.00019 ____ 0.00024
455 ______ 0.000312 ____ 0.00026 ____ 0.00032
456 ______ 0.005342 ____ 0.00439 ____ 0.00470
458 ______ 0.005804 ____ 0.00476 ____ 0.00484
459ab ____ 0.001176 ____ 0.00097 ____ 0.00091
460 ______ 0.002942 ____ 0.00241 ____ 0.00241
461 ______ 0.002327 ____ 0.00191 ____ -------
462 ______ 0.000532 ____ 0.00044 ____ -------
463 ______ 0.001623 ____ 0.00133 ____ -------
464abcd __ ------ * ____ ---- ** ____ 0.00279
570 ______ -------- ____ ------- ____ 0.00447
576 ______ -------- ____ ------- ____ 0.00549
607 ______ -------- ____ ------- ____ 0.00309
A10 ______ 0.003794 ____ 0.00311 ____ -------
C4 _______ 0.002355 ____ 0.00193 ____ -------
H4 _______ 0.003044 ____ 0.00250 ____ 0.00259
YCAIIab __ 0.001249 ____ 0.00102 ____ 0.00108
1B07 _____ 0.000925 ____ 0.00076 ____ -------
CDYab ____ -------- ____ ------- ____ 0.00672

 Panels:
FT1-12 ___ 0.002242 ____ 0.00184 ____ 0.00185 ____ 0.00399 ___ 0.00245
FT13-25 __ 0.002860 ____ 0.00235 ____ 0.00236 ____ 0.00481 ___ 0.00256
FT1-25 ___ 0.002560 ____ 0.00210 ____ 0.00211 ____ 0.00441 ___ 0.00261
FT1-37 ___ -------- ____ ------- ____ 0.00255 ____ 0.00541 ___ 0.00450
RG26 _____ 0.002020 ____ 0.00166 ____ -------
RG43 _____ 0.002410 ____ 0.00198 ____ -------
Norway10__ 0.002245 ____ 0.00184 ____ 0.00185 ***
YHRD10 ___ 0.002530 ____ 0.00208 ____ 0.00208 ****

* Used 0.00350 for calculating panel averages.
** Used 0.00287 for calculating panel averages.
*** Panel of ten markers used in Norwegian father-son study, with a
    measured average rate of 0.0020. (Dupuy et al. 2004).
**** Panel of ten markers with collected published (or almost
     published) results, including the Norwegion study, but
     not the same ten markers.

FOLLOWING MARKERS NOW OFFERED BY ETHNOANCESTRY:  (Examples of typical haplotypes in various haplogroups, and diversity in markers.)

  http://www.journals.uchicago.edu/AJHG/journal/issues/v74n6/41028/datafile1.txt

                       Allele Length of Eight Human DNA Samples
Locus                  Belonging to Eight Different Y-SNP Haplogroups
  ID      Diversity     A     B    C    E    I     J    K    R
DYF406S1   0.87       1*   4*    4*   3*        5*   5*
DYS481     0.86       1*   6*    5*   4*   4*   2*   1*   1*
DYS487     0.61       14   13    13   14   12   13   13   13
DYS490     0.60             16   14    12   12   12        12
DYS494     0.68       1*   1*    4*   1*   2*   2*   1*   2*
DYS505     0.79       13   11    12   13   12   13   10   12
DYS522     0.82        9    13   11   13   12   11   12    11
DYS531     0.71       12   13    11   11   12   12   12   13
DYS533     0.75       10     9   12   12   11   11    11   11
DYS549     0.79       13   10    12   13   12   12   13   14
DYS556     0.81        8         11   12   12   10    11   11
DYS575     0.64        9    12   10    8   10   10    10   10
DYS578     0.82        7     8    9    8    8     7   10    9
DYS589     0.82       2*   4*    1*   1*   3*   1*   2*   3*
DYS594     0.46       11     8   11   11   11   10    11   11
DYS636     0.64        9    12   10   10   10   10   10    11
DYS638     0.71       11   12    10   12   10   11   11   11
DYS641     0.64        9    10   10   11   10   10     7   10

MUTATION RATES: Following is a posting to the DNA List dated 14 Feb 2006 by Doug McDonald:

I have numerous "sets" of numbers. One is just the numbers from the Sorenson paper, normalized to my own average of the YHRD numbers and the Kerchner numbers, all properly weighted by number of instances, for the first FTDNA 12. The second is my own numbers, identically weighted, taken from data from Ysearch, using a properly weighted, for all Europe, set of data from R1b, R1a, I, and E3b. The third is just the average of those two sets, where they overlap.

For the 37 FTDNA numbers these values are (FTDNA order):

Sorenson Mine Average

0.000951331 0.000859077 0.000905204
0.003737371 0.002789068 0.003263219
0.001316574 0.001589313 0.001452943
0.002684112 0.003255742 0.002969927
0.002378327 0.001215556 0.001796941
0.002378327 0.003242745 0.002810536
0.000229339 0.000281880 0.00025561
0.000322773 0.000428446 0.00037561
0.003550502 0.004940802 0.004245652
0.001851697 0.002246961 0.002049329
0.001265610 0.000981038 0.001123324
0.002191458 0.002631745 0.002411602
0.004929932 0.005647866 0.005288899
0.001002295 0.000689137 0.000845716
0.001002295 0.001799793 0.001401044
0.000265014 0.000287363 0.000276189
0.000199610 8.66819E-05 0.000143146
0.003305025 0.003226596 0.003265811
0.001490701 0.001404251 0.001447476
0.002017331 0.001781656 0.001899493
0.005490537 0.006559247 0.006024892
0.003351974 0.001770982 0.002561478
0.003351974 0.002595981 0.002973977
0.003351974 0.004238435 0.003795204
0.003351974 0.003653918 0.003502946
0.002497243 0.003594258 0.003045751
0.002585581 0.003334444 0.002960012
0.001060904 0.000457712 0.000759308
0.001060904 0.002310783 0.001685843
0.004613954 0.005923067 0.00526851
0.007209039 0.003959481 0.00558426
0.007668214 0.007930994 0.007799604
0.006198855 0.006023698 0.006111277
0.011020000 0.009147722 0.010083861
0.011020188 0.009531934 0.010276061
0.002604268 0.003428091 0.00301618
0.000864692 0.000853537 0.000859114

where all those extraneous decimal places are due to the normalization.

I would suggest that one consider the Sorenson rates currently the "best" and the difference between theirs and mine as an example of the "typical expected error".

Note the big difference in mine and Sorenson's for the multiple markers like 464 and YCAII. This is because mine actually take into account the difference in mutation between the higher and lower allele values as actually found in Ysearch for the different a, b, c, d, etc.

Doug

Posting to DNA Forum re mutation rates of new markers 29 May 2006

I have calculated rates of the new markers in the Butler paper, using the SMGF "slope" method. They are normalized to a combination of all father-son and genealogical line marker rates. For this normalization the FTDNA 12 normalizes to 0.002. I used only the "caucasian" data from Butler. This is a painful process because the data is in pdf form and has to be printed out and laboriously scanned back in.

Here they are:

DYS444 0.00224
DYS446 0.00319
DYS449 0.00563
DYS463 0.00204
DYS485 0.00241
DYS495 0.00131
DYS505 0.00408
DYS508 0.00136
DYS520 0.00216
DYS522 0.00451
DYS532 0.00531
DYS533 0.00329
DYS534 0.00548
DYS540 0.00192
DYS556 0.00082
DYS557 0.00358
DYS570 0.00478
DYS576 0.00552
DYS594 0.00074
DYS635 0.00276
DYS643 0.00157

The average of these is in the .0027 range.

Doug McDonald
 

DNA List posting 8/09/06:
Estimate is the average mutation rate of markers 1-37, is 2.3 x faster than the 38-67 markers.

http://www3.interscience.wiley.com/cgi-bin/abstract/112101932/ (Mutation rate study)

Mutation rate related to allele length:
http://www.vizachero.com/images/AlleleComp.pdf

Forum Posting:
http://www.familytreedna.com/forum/showthread.php?t=3776

DYS413a - 0.0074
DYS413b - 0.0074
DYS434 - 0.0005
DYS435 - 0.0013
DYS436 - 0.0017
DYS441 - 0.0025
DYS444 - 0.0036
DYS445 - 0.0023
DYS446 - 0.0036
DYS452 - 0.0027
DYS461 - 0.0038
DYS462 - 0.0017
DYS463 - 0.0105
DYS485 - 0.0039
DYS495 - 0.0034
DYS635 - 0.0055
DYS643 - 0.0029
DYS714 - 0.0084
DYS716 - 0.0048
DYS717 - 0.0052
DYS726 - 0.0018
Y-GGAAT-1B07 - 0.001
Y-GATA-A10 - 0.0043

Mutation rates:

http://en.wikipedia.org/wiki/List_of_DYS_markers#Mutation_rates


Mutation rates observed in Charles Kerchner survey- DNA forum posting 27 Sept 07:

Observed YSTR Haplotype Mutation Rates in Surname Projects Recap:

FTDNA YSTR Panel or ----- ----- Observed
Haplotype Size ----- ----- Mutation Rate

12(1-12) panel ----- ----- 0.0025
13(13-25) panel ----- ----- 0.0029
12(26-37) panel ----- ----- 0.0066
30(38-67) panel ----- ----- 0.0022
12(1-12) YDNA12 ----- ----- 0.0025
25(1-25) YDNA25 ----- ----- 0.0027
37(1-37) YDNA37 ----- ----- 0.0041

(Average for 67 markers about 0.0032)


9) TIME TO MOST RECENT COMMON ANCESTOR (TMRCA):

This is a subject which causes blood pressure to rise amongst some "experts" on DNA.  Different authorities give various statistical projections about how far back it likely is to a common ancestor for two persons with a particular match or near match in DNA.  These estimates often give a "most likely" TMRCA, however, if you read the fine print, they all give a huge range of "other possibilities" if you consider probabilites possible within a 5% to 95% confidence range.  Further, the various authorities base their estimates on assumed data, which often varies between "experts", and generally widely differing mutation rates are averaged, not taking into consideration mutation rates of individual markers which mutate. 

The problem is, that persons who don't understand the concept of statistical probabilites well, tend to miss use the data, and make inappropriate conclusions.  TMRCA estimates can be helpful, but they have to be taken into consideration in conjunction with other evidence.

Following is an exert from a DNA Forum posting 1 May 04 by Richard Cottrell which he has based on an average mutation rate of 0.002.  The "average" muttion rate will vary depending on the individual markers in the set being considered.  Some test companies have faster mutating markers in their sets of markers which they offer than offered other test companies.  There are different views on what the average mutation rate is, FTDNA using faster rates in their TMRCA calculators than some other companies, but they have not released their research data to support these faster rates.  There seems a lot of support for 0.002 the avarage mutation rate for commonly tested markers.

TMRCA estimates...

These are all based on u=.002  ! Please remember it is just an estimation !

48/48 match will yield 50% within 3.6 generations and 95% within 16.07 generations

47/48 match will yield 50% within 8.8 generations and 95% within 25 generations

46/48 match will yield within 50% 14.2 generations and 95% within 33 generations

In comparison with the 37 and 43 marker MRCA:

37/37 match will yield 50% within 4.7 generations and 95% within 20.0 generations

43/43 match will yield 50% within 4.0 generations and 95% within 17.9 generations


DNA Forum Posting 19 Dec 2008 with estimates of mutation rates of markers:

Marker Type Rate Testing Company

472 slow 0.00001 FTDNA

578 slow 0.00008 FTDNA

426 slow 0.00009 FTDNA, SMGF

454 slow 0.00016 FTDNA, SMGF

455 slow 0.00016 FTDNA, SMGF

425 slow 0.00018 FTDNA

436 slow 0.00018 FTDNA

641 slow 0.00018 FTDNA

490 slow 0.00019 FTDNA

450 slow 0.0002 FTDNA

388 slow 0.00022 FTDNA, SMGF

594 slow 0.00029 FTDNA

395s1 slow 0.00031 FTDNA

395s1 slow 0.00031 FTDNA

640 slow 0.00034 FTDNA

531 slow 0.00037 FTDNA

492 slow 0.00042 FTDNA

617 slow 0.00042 FTDNA

392 slow 0.00052 FTDNA, SMGF

462 slow 0.00053 SMGF

568 slow 0.00053 FTDNA

590 slow 0.00054 FTDNA

438 slow 0.00055 FTDNA, SMGF

537 slow 0.00057 FTDNA

393 slow 0.00076 FTDNA, SMGF

565 slow 0.00087 FTDNA

B07 slow 0.00093 SMGF

445 slow 0.000952 SMGF

487 slow 0.00097 FTDNA

437 slow 0.00099 FTDNA, SMGF

YCAIIa medium 0.00123 FTDNA, SMGF

YCAIIb medium 0.00123 FTDNA, SMGF

511 medium 0.00128 FTDNA

441 medium 0.00132 SMGF

459a medium 0.00132 FTDNA, SMGF

459b medium 0.00132 FTDNA, SMGF

448 medium 0.00135 FTDNA, SMGF

19 medium 0.00151 FTDNA, SMGF

406s1 medium 0.00154 FTDNA

463 medium 0.00162 SMGF

452 medium 0.001743 SMGF

389i medium 0.00186 FTDNA, SMGF

413a medium 0.00202 FTDNA

413b medium 0.00202 FTDNA

H4 medium 0.00208 FTDNA, SMGF

572 medium 0.00212 FTDNA

385a medium 0.00226 FTDNA, SMGF

385b medium 0.00226 FTDNA, SMGF

461 medium 0.00233 SMGF

C4 medium 0.00236 SMGF

389ii medium 0.00242 FTDNA, SMGF

520 medium 0.00245 FTDNA

447 medium 0.00264 FTDNA, SMGF

391 medium 0.00265 FTDNA, SMGF

390 medium 0.00311 FTDNA, SMGF

444 medium 0.00321 FTDNA, SMGF

557 medium 0.00321 FTDNA

442 medium 0.00324 FTDNA, SMGF

446 medium 0.00365 FTDNA, SMGF

A10 medium 0.00379 SMGF

460 medium 0.00402 FTDNA, SMGF

607 medium 0.00411 FTDNA

439 medium 0.00477 FTDNA, SMGF

481 fast 0.00544 FTDNA

464a fast 0.00566 FTDNA, SMGF

464b fast 0.00566 FTDNA, SMGF

464c fast 0.00566 FTDNA, SMGF

464d fast 0.00566 FTDNA, SMGF

456 fast 0.00735 FTDNA, SMGF

570 fast 0.0079 FTDNA

458 fast 0.00814 FTDNA, SMGF

534 fast 0.00832 FTDNA

449 fast 0.00838 FTDNA, SMGF

576 fast 0.01022 FTDNA

CDYa fast 0.03531 FTDNA

CDYb fast 0.03531 FTDNA



Following are some other references on TMRCA etc...

http://nitro.biosci.arizona.edu/ftdna/TMRCA.htm
http://members.aol.com/dnafiler/MutationCalculator.exe   (Anne Turner's Time to MRCA calculator)
http://www.bearport.org/Downloads/MRCAChart-b.4.zip   (alternative Time to MRCA calculator)
http://blairgenealogy.com/dna/markers.html   (Marker analysis)***
http://nitro.biosci.arizona.edu/ftDNA/Distance.html   (Genetic distance calculations)
http://www.cottrellweb.com/dna/mrca-12.htm   (probabilies re TMRCA for 12 markers)
http://www.cottrellweb.com/dna/mrca-25.htm   (probabilies re TMRCA for 25 markers)
http://www.cottrellweb.com/dna/mrca-37.htm   (probabilies re TMRCA for 37 markers)
http://www.cottrellweb.com/dna/mrca-43.htm   (probabilies re TMRCA for 43 markers)

 

__________________________________________________________________________
Return to Home Page: